Department Of Education - Gujarat

33461929 bids are invited for ammonium dihydrogen orthophosphate , ammonium carbonate , ammonium ferrous sulphate , ammonium acetate , ammonium sulphate , aluminium sulphate , ammonium molybdate , ammonium bromide , strontium chloride , aluminium phosphate , barium nitrate , barium chloride , bismuth nitrate , barium carbonate , barium sulphate , brass alloy , barium phosphate , copper chloride , cadmium sulphate , cobalt nitrate , calcium carbonate , cobalt carbonate , calcium sulphate , strontium bromide , ethylene diamine tetra acetate , ferrous sulphate , ferric chloride , ferrous sulphide fused stick , lead acetate , magnesium carbonate , magnesium phosphate , manganese dioxide , manganese carbonate , magnesium sulphate , nickel sulphate , nickel carbonate , nickel chloride , potassium hydrogen phthalate , potassium iodide , potassium permanganate , potassium hydroxide , potassium bromide , sodium thiosulphate , strontium nitrate , strontium carbonate , sodium bromide , sodium chloride , silver nitrate , zinc sulphate , zirconyl nitrate , zinc phosphate , zinc sulphide , zinc carbonate , potassium chromate , strotium bromide , potassium chloride , potassium nitrite , conc hydrocholric acid , conc hydrocholric acid com , conc sulphuric acid , conc nitric acid , methyl acetate , benzaldehyde , methyl orange , benzoic acid , oxalic acid , phenyl acetic acid , salicylic acid , cinnamic acid , succinic acid , alpha naphthol , beta naphthol , ortho nitro phenol , resorcinol , phenol , ortho nitro aniline , para nitro aniline , meta nitro aniline , para toludine , acetanilide , anthracene , acetophenone , acetone , glacial acetic acid , biphenyl , benzamide , benzene , chloroform , naphthalene , para dichloro benzene , thiourea , urea , diethyl aniline , dimethyl aniline , alanine , methionine , aspirine , liquid parafin , ninhydrine , dimethyl glyoxime , starch powder , iodine , formaldehyde , potassium sodium tartrate , glycine , potassium dihydrogen phosphate , ethyl acetate , sodium citrate , magnesium chloride hexahydrate , bromocresol green , barfoeds reagent , hydrogen peroxide 30 volume , sodium oxalate , erichrome black t , cupric acetate , methyl red , glyoxylic acid , lactose , sodium iodide , standard buffer tablets ph 4 , standard buffer tablets ph 7 , standard buffer tablets ph 9 2 , amino napthol sulphonic acid , invertase , tryptophan , threonine , proline , aspargine , arginine , tyrosine , albumin , cysteine...

Department Of Education - Gujarat

33196414 bids are invited for n butanol , strontium bromide , sodium bisulfite , zinc sulphide , barium chloride , ferrous sulphide sticks , manganese chloride , manganese sulphate , nickel chloride , sodium chloride , sodium bi carbonate , potassium chloride , glycine , methanol , acetone , hydrochloric acid hcl , glacial acetic acid , potassium chromate , ammonia , potassium iodide , starch powder rice starch , iodine solution , acetocarmine , sodium hydroxide , acetorcien , blood group kit , ninhydrin , alanine , arganine , copper sulphate , sulphuric acid , whatman no.1 filter paper , ammonium sulphate , ammonium hydroxide , ammonia soln abt 30 percentage , fehling a , fehling b , methylene blue , murexide , potassium oxalate soln., potassium hydroxide pellets , potassiumdihydrogen phosphate soln. , silver nitrate , ferricacetate , ferric ammonium sulphate , methylorange , sodium acetate , cobalt chloride solution, bromothymal blue , 50 percentage or 70 percentageethyl alcohol 90 cc , cotton blue , lactophenol , iso propylalchohol , tryptophan , 1 percentage phenylalanine , 1percentage alanin , sodium carbonate , standardglycine soln , leucine , aspartic acid , 5 percentageegg white albumin , methionine , valine , lens cleaningsolution total quantity : 49451...

Department Of Education - Gujarat

33123108 bids are invited for lead nitrate ( q3 ) , glacial acetic acid ( q3 ) , ammonium sulphate ( q3 ) , benzamide ( q3 ) , benzene as per is: 534 ( q3 ) , borax as per is : 1109 ( q2 ) , boric acid as per is:10116 ( q3 ) , calcium chloride dihydrate is: 10758 ( q3 ) , thiourea ( q3 ) , hydrogen peroxide solution ( q3 ) total quantity : 16...

Department Of Education - Gujarat

33090776 bids are invited for n butanol , strontium bromide , sodium bisulfite , zinc sulphide , barium chloride , ferrous sulphide sticks , manganese chloride , manganese sulphate , nickel chloride , sodium chloride , sodium bi carbonate , potassium chloride , glycine , methanol , acetone , hydrochloric acid hcl , glacial acetic acid , potassium chromate , ammonia , potassium iodide , starch powder rice starch , iodine solution , acetocarmine , sodium hydroxide , acetorcien , blood group kit , ninhydrin , alanine , arganine , copper sulphate , sulphuric acid , whatman no.1 filter paper , ammonium sulphate , ammonium hydroxide , ammonia soln abt 30 percentage , fehling a , fehling b , methylene blue , murexide , potassium oxalate soln., potassium hydroxide pellets , potassiumdihydrogen phosphate soln. , silver nitrate , ferricacetate , ferric ammonium sulphate , methylorange , ammonium chloride , sodium acetate , cobalt chloride solution , bromothymal blue , 50percentage or 70 percentage ethyl alcohol 90 cc , cottonblue , lactophenol , iso propyl alchohol , tryptophan , 1percentage phenylalanine , 1 percentage alanin , sodiumcarbonate , standard glycine soln , leucine , aspartic acid , 5 percentage egg white albumin , methionine , valine , lens cleaning solution total quantity : 49951...

Civil Hospital - Gujarat

33038199 laboratory equipments micro biology ( part 1) 22% bovine albumin,5 % oxallic acid,5% hypo solution,acetone (ar),acid glacial acetic,acid sulphuric,afp,alcian blue dye 8gx dye (c.i 74240),alum,aluminum ammonium sulphate(iron alyn),aluminum sulphate,amacr,ammonia liq.,ammonium hydroxide,ammonium sulphate,anti c antisera,anti human globulin,anti human globulin,anti a,anti a 1,anti ab,anti b,anti d,aptt reagent for acl top cts 300,assayed biochemistry control for micro protein,assayed biochemistry control for total protein and sugar,barium chloride,basic fuschin ar,basolyse,basolyse ii abx,bcl 6,bcl 2,benedicts solution,biebrich scarlet (c.i 26905),biofix sprey,borex powder,braf,brca,brilliant crystle blue,buffer for pbs (ready to use)(phosphate buffer),buffered formalin,ca 19 9,ca 125,calcitonin,calibration plasma for acl top cts 300,calponin,calretinin,cam 5.2,carbol fuschin solution (z n stain),carbon fuchshin (ff) (ready to use),cd 138,cd 21,cd 31,cd 68,cd10,cd117,cd15,cd2,cd20,cd23,cd3,cd30,cd31,cd33,cd34,cd4,cd45(lca),cd45(ro),cd5,cd56,cd99,cdx2,cea,cedar wood oil,charcoal,chromic acid (chromium trioxide)powder,chromogranin,citrate vaccute(3ml),citrate buffer ph 6,ck 20,ck 5/6,ck 7,ck(pancytokeratin),ck: 34ß e12,ck 19,ck5,ck6,clean a for acl top cts 300,clean b for acl top cts 300,cleaner abx,cock tails,34/3 e 12,collagen iv,congo red (ready to use),congo red powder,copper sulphate ar,cyclin d1,cytokeratin ae1/ae3,d.p.x.,dab chromogen,d dimer controls level 1 & 2,d dimer reagent for acl top cts 300,desmin,diluent abx,dist. water,double distilled water,drabkins solution for hemoglobin with hemoglobin standard,edta sodium salt powder,e.d.t.a.dipotassium salt dihydrate purified,ea – 36 or ea – 50 (pap stain),e cadherin,egfr,ehrlich’s reagent,ema,eosin (ready to use),eosin (y),eosinofix abx,er (breast receptor),esr control for westergen method,esr latex control,esr smart card,f viii r ag,factor diluent for acl top cts 300,factor ix deficient plasma for acl top cts 300,factor viii deficient plasma for acl top cts 300,fascin,fast green dye,ferric ammonium sulphate,ferric chloride,ferric chloride solution,fibrinogen c reagent for acl top cts 300,field stain a,field stain b,fish probe 1 p 36 kit,fish probe 1 q 25 kit,fish probe 19 q 13 kit,fish probe egfr kit,fluocyte,fontanna stain ready to use,formalin,fouchets reagent,g m s stain ready to use,g6pd test kit qualitative anaysis (ready to use),g6pd test kit quantitative anaysis (ready to use),gfap,ghb kits,giemsa (ready to use) with buffer,giemsa (ready to use) stain,giemsa (ready to use) with buffer,giemsa powder,glucose kit for csf,glycerin ip,glycerol liquid,gold chloride,haematoxylin (ready to use),hba1c with card,hcg,hcl,hematology control,hemotoxyline,her 2 neu,hexaamine(hexamethelentetraamine),hgo(25gm),hmb 45,idh 1 mutant,idh wild type,immunofluroscent reagent kit , polyclonal rabbit anti human c1q complement/fitc,immunofluroscent reagent kit , polyclonal rabbit anti human albumin/fitc,immunofluroscent reagent kit , polyclonal rabbit anti human c3c complement /fitc,immunofluroscent reagent kit , polyclonal rabbit anti human fibronogen/fitc,immunofluroscent reagent kit , polyclonal rabbit anti human iga/fitc,immunofluroscent reagent kit , polyclonal rabbit anti human igg/fitc,immunofluroscent reagent kit , polyclonal rabbit anti human igm/fitc,immunofluroscent reagent kit , polyclonal rabbit anti human kappa chain/fitc,immunofluroscent reagent kit , polyclonal rabbit anti human lamda chain/fitc,iso propyl alcohol,kh2po4,ki 63,ki 67,koh powder ep,l poly lysine,leishmen stain powder,leishmen stain ready to use with buffer,light green yellowish (c.i 42095),litmus paper blue & red,lugol’s iodine,lyse bio abx,malaria kit (antigen detection),masson fontana stain kit(ready to use),massons trichome (ready to use),melan a,meno cleaner abx,mercuric oxide,methanol,methyl green,methyl green pyronin stain kit (ready to use ),methylene blue powder,methylene blue solution,mg stain(125ml)ready to use,mib 1,micro albumin/protein kit for urine,micro protein kit for csf,minoclair,muc 2,musicarmine stain kit (ready to use),myloperoxidase (mp) kit (ready to use),myod1,myogenin/myosin,na acetate,na2hpo4,neuro filament,neuron specific enolase (nse),neutral red powder,new methylene blue,nitric acid,normal control assayed for acl top cts 300,nse,nucediff,occult blood test kit(haem tests),oct 4.,og – 6 solution (pap stain),oil red o powder,oil red o stain kit (ready to use ),orange g solution (c.i 16230),orcein dye (c.i 19140),orcein powder,orcein stain ready to use,oxalic acid(purified),p 16,p 53,ptah stain ready to use,p.a.s. (periodic acid schiff)(ready to use),p63,paraffin block,paraffin wax,pax 5,pax 8,pearl stain (ready to use),per iodic acid,peroxide block,peroxide detection system with dab,peroxide detection tnl system with dab,phenol crystals,phosphotungstic solution,phosphate buffer(ph 7.2 7.8),phospho molybdic acid,phospho tungstic acid,picric acid,platelet diluting fluid,polymer hrp,polymer kit with dab solution for ihc,polymer hrp ihc dtection system kit (contain dab buffer,dab chomogen,super enhancer,poly hrp reagent,peroxide block,power block),potassium dihydro phosphate powder,potassium ferrocyanide powder,potassium iodide,potassium permanganate,potatium metabisulphate,power block,pr (breast receptor),propylene glycol,protein kit for fluid,prussian blue kit ready to use,psa ihc kit,pyronin,rapid fructose kit,rbc diluting fluid,reagent for drvvt confirm for acl top cts 300,reagent for drvvt screen for acl top cts 300,recombiplastin 2g (pt reagent) for acl top cts 300,reticulocyte stain,reticulin stain (ready to use),rinse solution for acl top cts 300,s 100,saffranin powder,saffranin stain kit (ready to use )ab ph 2.5,sickle kit (ready to use),silver nitrate,sma(smooth muscle actin),sodium bicarbonate,sodium chloride,sodium citrate (3% to 8%),sodium hydroxide,sodium metabisulphate,sodium nitroprusside,sodium phosphate dibasic anhydrous,sodium phosphate dibasic(br),sodium phosphate monobasic monohydrate,sodium sulphate,sodium thiosulphate,stable dab buffer,steel ball,sudan black (ready to use),sudan black b,sulfosalicylic acid,sulphur powder,super enhancer,synaptophysin,thioflavin t,thymol,toludin blue kit ready to use,toludine blue,toludine blue dye (c.i 52040),total protein estimation kit,tris edta buffer ph 9,tris powder,ttf1,tween 20,urine control,van geisons stain (ready to use),vimentin,von kossa stain kit (ready to use ),wbc diluting fluid,whitediff h550,wright stain,wt 1,xylene,ziehl neelson (ready to use),ß catenin...

Civil Hospital - Gujarat

33036816 laboratory equipments pathology ( consumables items, disposable items, major equipments and minor equipments ( part 1 ) 22% bovine albumin, 5 % oxallic acid, 5% hypo solution, acetone ( ar ) , acid glacial acetic, acid sulphuric, afp, alcian blue dye 8gx dye ( c.i 74240 ) , alum, aluminum ammonium sulphate ( iron alyn ) , aluminum sulphate, amacr, ammonia liq., ammonium hydroxide, ammonium sulphate, anti c antisera, anti human globulin, anti human globulin, anti a, anti a 1, anti ab, anti b, anti d, aptt reagent for acl top cts 300, assayed biochemistry control for micro protein, assayed biochemistry control for total protein and sugar, barium chloride, basic fuschin ar, basolyse, basolyse ii abx, bcl 6, bcl 2, benedicts solution, biebrich scarlet ( c.i 26905 ) , biofix sprey, borex powder, braf, brca, brilliant crystle blue, buffer for pbs ( ready to use ) ( phosphate buffer ) , buffered formalin, ca 19 9, ca 125, calcitonin, calibration plasma for acl top cts 300, calponin, calretinin, cam 5.2, carbol fuschin solution ( z n stain ) , carbon fuchshin ( ff ) ( ready to use ) , acrylic jar, acrylic jar, acrylic jar, beaker glass autoclavable, beaker glass autoclavable, beaker glass autoclavable, beaker glass autoclavable, beaker glass autoclavable, bio tips ( microtips ) , bio tips ( microtips ) , bio tips ( microtips ) , bio tips ( microtips ) , bio tips ( microtips ) , bio tips ( microtips ) , biotips ( disposable ) for micropipette, biotips ( disposable ) for micropipette, biotips ( disposable ) for micropipette, blood group tile, blotting paper sheet, brush for test tube cleaning different sizes, circled slides for cytospin centrifuge, coplin jar & lid, coverglass ( microscopic ) , coverglass ( microscopic ) , cup for acl top cts 300, cuvette for acl top cts 300, diamond pencil, disposable urine container*, dropper, eppendrof cups, eppendrof cups, esr pipette ( westergren ) *, esr vacuette, filter cards, filter paper, funnel plastic, glass beaker, glass beaker, glass beaker, glass beaker, glass beaker, glass capillaries, glass jar, glass rods, glass rods stand ( ready to use ) , glass slide ( frosted ) , halogen lamp for microscope, hb pipette, hb square tubes, kahn tube, cd 138, cd 21, cd 31, cd 68, cd10, cd117, cd15, cd2, cd20, cd23, cd3, cd30, cd31, cd33, cd34, cd4, cd45 ( lca ) , cd45 ( ro ) , cd5, cd56, cd99, cdx2, cea, cedar wood oil, charcoal, chromic acid ( chromium trioxide ) powder, chromogranin, citrate vaccute ( 3ml ) , citrate buffer ph 6, ck 20, ck 5 / 6, ck 7, ck ( pancytokeratin ) , ck: 34ß e12, ck 19, ck5, ck6, clean a for acl top cts 300, clean b for acl top cts 300, cleaner abx, cock tails, 34 / 3 e 12, collagen iv, congo red ( ready to use ) , congo red powder, copper sulphate ar, cyclin d1, cytokeratin ae1 / ae3, d.p.x., dab chromogen, d dimer controls level 1 & 2, d dimer reagent for acl top cts 300, desmin, diluent abx, dist. water, double distilled water, drabkins solution for hemoglobin with hemoglobin standard, edta sodium salt powder, e.d.t.a.dipotassium salt dihydrate purified, ea – 36 or ea – 50 ( pap stain ) , e cadherin, egfr, ehrlich’s reagent, ema, eosin ( ready to use ) , eosin ( y ) , eosinofix abx, er ( breast receptor ) , esr control for westergen method, esr latex control, esr smart card, f viii r ag, factor diluent for acl top cts 300, factor ix deficient plasma for acl top cts 300, factor viii deficient plasma for acl top cts 300, fascin, fast green dye, ferric ammonium sulphate, ferric chloride, ferric chloride solution, fibrinogen c reagent for acl top cts 300, field stain a, field stain b, fish probe 1 p 36 kit, fish probe 1 q 25 kit, fish probe 19 q 13 kit, fish probe egfr kit, fluocyte, fontanna stain ready to use, formalin, fouchets reagent, g m s stain ready to use, g6pd test kit qualitative anaysis ( ready to use ) , g6pd test kit quantitative anaysis ( ready to use ) , gfap, ghb kits, giemsa ( ready to use ) with buffer, giemsa ( ready to use ) stain, giemsa ( ready to use ) with buffer, giemsa powder, glucose kit for csf, glycerin ip, glycerol liquid, gold chloride, haematoxylin ( ready to use ) , hba1c with card, hcg, hcl, hematology control, hemotoxyline, her 2 neu, hexaamine ( hexamethelentetraamine ) , hgo ( 25gm ) , hmb 45, idh 1 mutant, idh wild type, immunofluroscent reagent kit , polyclonal rabbit anti human c1q complement / fitc, immunofluroscent reagent kit , polyclonal rabbit anti human albumin / fitc, immunofluroscent reagent kit , polyclonal rabbit anti human c3c complement / fitc, immunofluroscent reagent kit , polyclonal rabbit anti human fibronogen / fitc, immunofluroscent reagent kit , polyclonal rabbit anti human iga / fitc, immunofluroscent reagent kit , polyclonal rabbit anti human igg / fitc, immunofluroscent reagent kit , polyclonal rabbit anti human igm / fitc, immunofluroscent reagent kit , polyclonal rabbit anti human kappa chain / fitc, immunofluroscent reagent kit , polyclonal rabbit anti human lamda chain / fitc, iso propyl alcohol, kh2po4, ki 63, ki 67, koh powder ep, l poly lysine, leishmen stain powder, leishmen stain ready to use with buffer, light green yellowish ( c.i 42095 ) , litmus paper blue & red, lugol’s iodine, lyse bio abx, malaria kit ( antigen detection ) , masson fontana stain kit ( ready to use ) , massons trichome ( ready to use ) , melan a, meno cleaner abx, mercuric oxide, methanol, methyl green, methyl green pyronin stain kit ( ready to use ) , methylene blue powder, methylene blue solution, mg stain ( 125ml ) ready to use, mib 1, micro albumin / protein kit for urine, micro protein kit for csf, minoclair, muc 2, musicarmine stain kit ( ready to use ) , myloperoxidase ( mp ) kit ( ready to use ) , myod1, myogenin / myosin, na acetate, na2hpo4, neuro filament, neuron specific enolase ( nse ) , neutral red powder, new methylene blue, nitric acid, normal control assayed for acl top cts 300, nse, nucediff, occult blood test kit ( haem tests ) , oct 4., og – 6 solution ( pap stain ) , oil red o powder, oil red o stain kit ( ready to use ) , orange g solution ( c.i 16230 ) , orcein dye ( c.i 19140 ) , orcein powder, orcein stain ready to use, oxalic acid ( purified ) , p 16, p 53, ptah stain ready to use, p.a.s. ( periodic acid schiff ) ( ready to use ) , p63, paraffin block, paraffin wax, pax 5, pax 8, pearl stain ( ready to use ) , per iodic acid, peroxide block, peroxide detection system with dab, peroxide detection tnl system with dab, phenol crystals, phosphotungstic solution, phosphate buffer ( ph 7.2 7.8 ) , phospho molybdic acid, phospho tungstic acid, picric acid, platelet diluting fluid, polymer hrp, polymer kit with dab solution for ihc, polymer hrp ihc dtection system kit ( contain dab buffer, dab chomogen, super enhancer, poly hrp reagent, peroxide block, power block ) , potassium dihydro phosphate powder, potassium ferrocyanide powder, potassium iodide, potassium permanganate, potatium metabisulphate, power block, pr ( breast receptor ) , propylene glycol, protein kit for fluid, prussian blue kit ready to use, psa ihc kit, pyronin, rapid fructose kit, rbc diluting fluid, reagent for drvvt confirm for acl top cts 300, reagent for drvvt screen for acl top cts 300, recombiplastin 2g ( pt reagent ) for acl top cts 300, reticulocyte stain, reticulin stain ( ready to use ) , rinse solution for acl top cts 300, s 100, saffranin powder, saffranin stain kit ( ready to use ) ab ph 2.5, sickle kit ( ready to use ) , silver nitrate, sma ( smooth muscle actin ) , sodium bicarbonate, sodium chloride, sodium citrate ( 3% to 8% ) , sodium hydroxide, sodium metabisulphate, sodium nitroprusside, sodium phosphate dibasic anhydrous, sodium phosphate dibasic ( br ) , sodium phosphate monobasic monohydrate, sodium sulphate, sodium thiosulphate, stable dab buffer, steel ball, sudan black ( ready to use ) , sudan black b, sulfosalicylic acid, sulphur powder, super enhancer, synaptophysin, thioflavin t, thymol, toludin blue kit ready to use, toludine blue...

Directorate Of Agriculture - Gujarat

32695829 bids are invited for l ascorbic acid ( q3 ) , ammonium acetate ar grade ( q3 ) barium chloride as per is: 5288 ( q3 ) , calcium chloride dihydrate is: 10758 ( q3 ) diethylenetriaminepenta acetic acid ( q3 ) glacial acetic acid ( q3 ) , hydrochloric acid as per is:265 ( q3 ) technical is 4150 ( q3 ) , potassium dihydrogen orthophosphate ( q3 ) dichromate ( q3 ) , sodium acetate ( q3 ) ( q3 ) , sucrose ( q3 ) , sulphuric acid as per is:266 ( q3 ) is:333 ( q3 ) , sodium hydroxide is:252 ( q3 ) total quantity : 1380...

Ministry Of Petroleum And Natural Gas - Gujarat

32687536 bids are invited for edta solution 0.02n (q3) , iso octane (q3) , ammonium ferrous sulphate hexahydrate (q3) , aluminium oxide (q3) ,glacial acetic acid (q3) total quantity : 61...

Health And Family Welfare Department - Gujarat

31545018 bids are invited for acetonitrile , glacial acetic acid , n hexane , methanol , formic acid , ethyl acetate , sodium chloride , sodium acetate anhydrous , graphatised carbon black , magnessium sulphate anhydrous , primary secondaryamine , c 18 , sodium citrate tribasic dihydrate , disodiumhydrogen citrate sequihydrate , hydrogen peroxide , nitricacid trace metal grade for icpms total quantity : 11738...

Health And Family Welfare Department - Gujarat

31159306 providing laboratory items pathology etc. in p.d.u.hospital, rajkot. (part 1) anti a monoclonal (5 ml),anti b monoclonal (5 ml),anti d monoclonal igg (5 ml),anti d monoclonal igg + igm blend (5 ml),anti ab monoclonal (5 ml),anti a 1 monoclonal (5 ml),anti h monoclonal (5 ml),anti human globulin polyspecific (5 ml),22 % bovine serum albumin (5 ml),hiv elisa test kits 4th generation,hiv rapid test kits,hcv elisa test kits 3rd generation,hcv rapid test kits,hbs ag elisa test kits,hbsag rapid test kits,rapid malaria antigen detection,rpr for syphilis detection,single blood bag (350 ml),double blood bags(350ml),double blood bags(450ml),triple blood bag (350 ml)without sample pouch,triple blood bag (450 ml)without sample pouch,triple blood bag (350 ml) with sample pouch,triple blood bag (450 ml) with sample pouch,quadruple blood bag (450 ml) top and top with sample pouch,quadruple blood bag (450 ml) top and top without sample pouch,quadruple blood bag (350 ml) top and top with sample pouch,quadruple blood bag (350 ml) top and top without sample pouch,transfer bags (100 ml) capacity,standard blood transfusion set,microcuvette for hb estimation in hemocue 301,microcuvette for hb estimation in compolab ts fresenius kabi,wafer for sterile tube connecting device (terumo penpol),cuso4 powder,sodium hypochloride,normal saline,inj. dextrose 25%,distilled water,barcode printing roll,barcode printing roll,barocode printer ribbon wax,edta vaccutte,plain vaccutte,glass test tube,glass test tube,cover slip,glass slide box,micropore tape,lancet,disposable yellow tips,temp. chart for jewett blood storage refrigerator,temp.chart for meditech deep freeze,temp.chart for haier (30c to 30c) deep freeze,temp.chart for remi (20c to 10c) storage refrigerator,temp.chart for techsonic ( 50c to +50c) storage refrigerator,temp.chart for platelet agitator terumopenpol,field stain a,field stain b,reticulocyte stain,perl’s stain,myloperoxidase stain,sudan black stain,leishman’s stain powder,periodic acid schiff(pas) stain,methylene blue powder,alkaline methylene blue,indian ink,drabkin’s solution,abx diluent (for 5 part cell counter horiba),abx basolyse 2 (for 5 part cell counter horiba),abx cleaner (for 5 part cell counter horiba),abx eosinofix (for 5 part cell counter horiba),abx lyse bio (for 5 part cell counter horiba),abx fluocyte (for 5 part cell counter horiba),abx minoclair (for 5 part cell counter horiba),haematology control set(low,normal,high) for 5part cell counter(horiba pentra xlr),isotonac – 3 (for 3 part cell counter nihon kohden),diluent isotonac – 3 (for 3 part cell counter nihon kohden),isotonac – 3 (for 5 part cell counter nihon kohden),diluent isotonac – 3 (for 5 part cell counter nihon kohden),hemolynac 3n (for 3 part cell counter nihon kohden),hemolynac 3n (for 5 part cell counter nihon kohden),clenac (for 3 part cell counter nihon kohden),clenac 3 (for 3 part cell counter nihon kohden),cell pack for kx 21 cell counter (sysmex),stromatolyser for kx 21 cell counter (sysmex),cell cleaner for kx 21 cell counter (sysmex),hematological control set for 3 part cell counter for sysmex kx 21 & nihon kohden,pt kit –for semiautomated coagulometer,aptt kit for semiautomated coagulometer,cuvette for semi autocoagulometer (arx clot),reaction tube for ca 50 semiautomated coagulomater,sta neoplastine(for stago sta compact coagulometer),sta c.k. prest(for stago sta compact coagulometer),sta calcium chloride (for stago sta compact coagulometer),sta desorb u(for stago sta compact coagulometer),sta cleaner(for stago sta compact coagulometer),sta coolant(for stago sta compact coagulometer),sta cuvette(for stago sta compact coagulometer),sta fibroprest (for stago sta compact coagulometer),sta deficient viii(for stago sta compact coagulometer),sta deficient ix(for stago sta compact coagulometer),sta liatest d di(for stago sta compact coagulometer),sta fdp(for stago sta compact coagulometer),sta liatest vwfag(for stago sta compact coagulometer),sta system control n + p (for stago sta compact coagulometer),sta liatest control n + p(for stago sta compact coagulometer),sta unicalibrator (for stago sta compact coagulometer),sta fdp calibrator(for stago sta compact coagulometer),sta vwf calibrator(for stago sta compact coagulometer),sta fdp control(for stago sta compact coagulometer),thermal paper roll size (50mm) ( for uro dipcheck 300 and ca50 coagulometer ),thermal paper roll, size (56mm) ( for cell counter kx 21, celltac alpha and arx clot),urine strips (glucose,protein andph)(transgesic/erba/rapha/reckon),urine strips (uro dip 10 a) for uro dip check 300 (erba),urine strip for acetone (erba/reckon/alcon),urine strips for ph,urine control level 1,urine control level 2,coomb’s antisera,antisera, a, b, rh,acetone detection powder,occult blood test,distilled water,benedict’s solution,acetic acid 5%,sodium dithionate powder,potassium di hydrogen orthophosphate powder (kh2po4),potassium phosphate dibasic(anhydrous)(k2hpo4),saponin,mp card,methanol,3% sulphosalicylic acid(crest/span/beacon),ph strip,ph tablet,blood spillage kit,mercury spillage kit,watmann filter paper no.4( 9 cm diameter),fouchet’s reagent,ehrlich’s reagent,citric acid,picric acid,barium chloride,sodium citrate powder,sodium di hydrogen orthophosphate powder (nah2po4) (crest/biolab/rfcl),sodium phosphate dibasic(anhydrous)(na2hpo4),phenol crystal,esbach’s albuminometer,ether,sodium metabisulphite,micro tips,tips for 2ml micropipette,tips for 5ml micropipette,yellowtip tipbox,cotton,surgical gloves,surgical gloves,surgical gloves,cap disposable,mask disposable,label sticker (small),blood lancet with round stylet,glass marker pencil (blue),glass marker pen (blue),glass marker pen (black),glass marker pen (red),oil emersion bottle,tissue paper roll,test tube brush,sodium hypo chloride 5%,diluent for micro 60 analyzer,lyser for micro 60 analyzer,cleaning solution for micro 60 analyzer,minoclair for micro 60 analyzer,control high value for micro 60 analyser,control low value for micro 60 analyser,drabkin’s reagent,bone marrow aspiration needle,jamshidi bonemarrow biopsy needle,micro slide(blue star/pfact/gold),cover slip(blue star/pfact/gold) no.1,english glass,each packet of 10 gm should contain minimum 25 coverglass dust free,haematological capillary for bt ct(blue star/toptech/goldstar),esr tube citrate filled( for automated esr analyser microsed 10)(nucleus/fine care/bluestar),test tube size (12x100 mm) (blue star/toptech/bonosilicate),cuvette for colorimeter (ei/toptech/gold),coverslip(bluestar/pfact/gold star) minimum 50 coverslips. per 10 gram,micro pipette (fixed volume),micro pipette (adjustable),digital ph meter,binocular microscope,lab. cell counter,microscope high power lens,microscope oil immersion lens,esr rack with graduation with compatible tubes,dpx mountant(glaxo,qualigen,rankem,merk),methanol –ar grade (glaxo,qualigen,rankem,merk),sputum container(sterile),filter paper round whatmann no. 1(125mm),giemsa stain(molychem,himedia),haematoxylin stain(harry’s) (glaxo,qualigen,rankem,merk,himedia),eosin (2%) stain(glaxo,qualigen,rankem,merk,himedia),xylene ar grade (glaxo,qualigen,rankem,merk),plastic gloves disposable,blotting paper sheet,10 ml disposable syringe(tigerjet),22g disposable needle,23g disposable needle,disposable spinal needle – 22g,latex rubber hand gloves size 6.5,latex rubber hand gloves size 7,latex rubber hand gloves size 7.5,5% hypochlorite solution,sterilium,distilled water,oil immersion for microscope,rapid pap stain kit(tulip,bio lab diagnostics),bleaching powder,phenyl,dextrose (25%) – d25,donor tape,micropore 1â€(hipore),couplin jar,disposable wooden spatula,cytocentrifuge filter paper,may grunward’s stain for cytopathology(microkrom,himedia),concentrated hydrochloric acid,face mask disposable,cap (disposable),gloves 6.5 number 7 number ( latex ),disposable plastic gloves.,label sticker (small) micro slide size,thermal paper roll size (56mm), for cell counter nihon kohden,tissue paper roll,glass marker pen (blue),glass marker pen (black),methanol,disposable syringe 2 ml,disposable syringe 5 ml,disposable syringe 10 ml,disposable needle 23 g,disposable needle 24 g,tourniquet belt for blood collection,lancet,vaccuttes edta (k2 or k3) capacity : 2 ml,micro tips for 20 micro liter pipettes,vaccuttes sodium citrate ( for prothrombin time),watman filter paper (9cm diameter), no.1 himedia /sigma/merck,watman filter paper (11cm diameter), no.1 himedia /sigma/merck,drabkins reagent for hb with standard provided in amber coloured bottle span/biolab/beacon/nichola,field stain a ready to use himedia/span/ biolab/ beacon,field stain b ready to use himedia/span/ biolab/ beacon,reticulocyte stain ready to use himedia, sigma, merck,leishman’s stain himedia/glaxo/sigma/ biolab,bacl2 10%,fouchet’s reagent himedia/span/ biolab/ beacon,oil emersion bottle merk, jk diagnostics,stool occult blood kit,urine pregnancy test kit (hcg strip) having separate control and test band result within 3 min sensitivity: upto 20miu/ml accuracy >99% ranbaxy/accucare/span,urine strip for detection of sugar & protein accuracy >99% result within 30 sec bayer/ span/ biolab,urine strip for acetone accuracy >99% result within 30 sec bayer/ span/ biolab,urine containers(disposable) 20 ml capacity,anti a antisera monoclonal,anti b antisera monoclonal,anti c antisera,anti d (rh) antisera monoclonal (blend of igg and igm) span, tulip, ranbaxy,anti d (rh) antisera monoclonal (blend of igg) span, tulip, ranbaxy,anti e antisera,anti fya antisera,anti fyb antisera,anti lea antisera,anti leb antisera,anti lua antisera,anti lub antisera,anti p antisera,anti k antisera,anti kpa antisera,anti kpb antisera,anti s antisera,anti s antisera,anti m antisera,anti n antisera,anti jsa antisera,anti jsb antisera,anti jka antisera,anti jkb antisera,anti cde antisera,lab wash solution,sodium hypochlorite (5%),rubber bulb for westerngreen tube,blood spillage kit,mercury spillage kit,hemolynec 3 for nihon kohden cell counter (5 part),hemolynec 5 for nihon kohden cell counter ( 5 part),isotenac – 3 for nihon kohden cell counter (5 part),clenac for nihon kohden cell counter (5 part),clenac – 3 for nihon kohden cell counter (5 part),hematological control set with reference value for nihon kohden celltac e (5 part) third party biorad, span, randox(except nihon kohden & horiba) containing low, normal, high level control,clenac – 3 for nihon kohden cell counter (3 part),clenac for nihon kohden cell counter (3 part),isotenac – 3 for nihon kohden cell counter (3part),hemolynec 3 n for nihon kohden cell counter (3 part),hematological control set with reference value for nihon kohden celltac e (3part) third party biorad, span, randox(except nihon kohden & sysmex) containing low, normal, high level control,micro slide size 26x76mm thick 1.1mm,cover slips size 22 x 22 mm,hematological capillary for bt ct,cuvatte for colorimeter size 12 mm dia, round, round bottom, glass,esr tubes (westergren),microscope lamp (halogen),esr tubes for automated esr analyzer, citrate prefilled,test tube 12*75mm size,laboratory thermometer glass 0 to 100 centigrade range,micro pipette (fixed volume),micro pipette (adjustablevolume,microscope high power lens,microscope eye piece,microscope oil immersion lens,photoelectric colorimeter,spare lamp /led for photoelectric colorimeter,binocular microscope,centrifuge (8 tube),lab. cell counter,semi automated esr analyzer,micropipette holder stand 5 pipette per stand,test tube brush for cleaning test tube,needle destroyer,surgical knife,disposable plastic hand gloves,gauze cloth,tissue paper roll,parafine wax with ceresin melting point 58 60 degree celsius (glaxo,qualigen,rankem,merk),formaline,formaline,acetone ar grade ,(glaxo,qualigen,rankem,merk),xyline ar grade, (glaxo,qualigen,rankem,merk),methanol ar grade, (glaxo,qualigen,rankem,merk),propanol ar grade (glaxo,qualigen,rankem,merk),dpx moutant (glaxo,qualigen,rankem,merk),tween 20,tris base,edta dipotassium salt,sodium chloride (ar grade),hydrogen peroxide (30%),sodium hydroxide,filter paper sheets 46 x 57 cm.size , for the use in tissue processing, watman no.1,microtome blade (disposable) law profile, for use in hm 325 microtome,distilled water,nitric acid (concentrated),hydrochloric acid (concentrated),glacial acetic acid (concentrated),formic acid ( concentrated)...

Department Of Space - Gujarat

30705733 bids are invited for nitric acid 67 69% optima grade fisher mak , ammonium hydroxide optima grade fisher make , glacial acetic acid optima grade fisher make , ultrapure hydrochloric acid35% for ultra trace analysis optima grade fisher makeboq title fisher make optima grade chemicals 2021000356 total quantity : 4...

Junagadh Agricultural University - Gujarat

30649281 bids are invited for hexadecenyl bromide 250gm molecular formula c16h33br molecular weight ( g / mol ) 305.34 percent purity 99+% flash point 176°c ( 348°f ) odor odorless melting point 16°c to 18°c density 1 boiling point 336°c refractive index 1.462 , 1 octyne 100gm density 0.746 melting point 60°c boiling point 123°c to 126°c flash point 17°c ( 62°f ) assay percent range 99% linear formula ch3 ( ch2 ) 5c=ch un number un3295 beilstein 1734494 refractive index 1.416 pack size : 100 gm solubility information miscible with alcohol, ether and other organic solvents. immiscible with water. formula weight 110.2 physical form liquid percent purity 98% chemical name or material 1 octyne , 2.5 n buli in hexane 800ml density 0.6900g / ml melting point 95.0°c boiling point 60.0°c to 80.0°c flash point 21°c linear formula ch3 ( ch2 ) 3li packaging acroseal™ glass bottle fieser 01, 95; 02, 51; 04, 60; 05, 78; 06, 85; 07, 45; 08, 65; 09, 83; 10, 68; 11, 101; 12, 96; 13, 56; 14, 63; 15, 59; 16, 55; 17, 59 pack size : 800ml specific gravity 0.69 formula weight 64.06 chemical name or material n butyllithium, 2.5m solution in hexanes , 1 bromo 8 tetrahydropyranyloxy octane 25 gm boiling point 130°c to 132°c ( 0.8mmhg ) flash point >110°c ( 230°f ) beilstein 1306644 refractive index 1.477 pack size 25 gm formula weight 293.25 percent purity 92% grade technical chemical name or material 2 ( 8 bromooctyloxy ) tetrahydropyran , pd ( oac ) 2 palladium ( ii ) acetate 1 gm assay percent range 45.9 to 49.5% appearance various forms in red brown color ( powder / flake / crystalline / beads ) solubility information soluble as monomer in glacial acetic acid or as trimer in benzene. formula weight 673.46 physical form needles color red to brown melting point ?205°c ( decomposition ) pack size 1 gm chemical name or material palladium ( ii ) acetate , koh potassium hydroxide 500gm density 2.044 solubility information freely soluble in water. soluble in ethanol. formula weight 56.11 odor odorless ph 13.5 melting point 360°c boiling point 1320°c to 1324°c pack size 500g sensitivity air sensitive; hygroscopic , ptsa.h2o=p toluenesulfonic acid monohydrate 500 gm assay percent range 97.5% un number un2585 beilstein 3568023 merck index 14, 9533 density 1.24 g / ml formula weight 190.22 ( 172.20 anhydrous ) physical form crystalline percent purity 97% odor mild melting point 103°c to 106°c ( anhydrous ) color pink to white boiling point 140°c ( 20mmhg ) pack size 500g flash point 150°c ( 302°f ) sensitivity hygroscopic chemical name or material p toluenesulfonic acid monohydrate , pcc=pyridinium chlorochromate 100gm melting point ~206°c ( decomposition ) un number un1479 merck index 14, 7974 pck size 100g solubility information soluble in acetone, benzene, dichloromethane, acetonitrile and tetrahydrofuran. sensitivity moisture sensitive formula weight 215.56 percent purity 99% chemical name or material pyridinium chlorochromate , n butyl magnesium chloride 50ml color brown linear formula ch3 ( ch2 ) 3mgcl un number un3399 beilstein 3587228 packaging chemseal™ bottles pack size 50ml solubility information reacts with water. sensitivity air and moisture sensitive formula weight 116.87 physical form liquid concentration or composition ( by analyte or components ) 1.5 to 2.5m in thf chemical name or material n butylmagnesium chloride , titanium tetra chloride 100gm assay percent range 99.999% ( metals basis ) solubility information miscible with ethanol, hydrochloric acid and organic solvents. formula weight 189.69 physical form liquid density 1.726 g / ml refractive index 1.61 sensitivity moisture sensitive boiling point 136°c to 137°c melting point °c to 25°c pack size 100g , 1 hexyne 250gm density 0.718 melting point 132°c boiling point 69°c to 71°c flash point 21°c ( 5°f ) odor characteristic un number un3295 beilstein 635687 refractive index 1.399 pack size 250g solubility information miscible with organic solvents. immiscible with water. formula weight 82.15 percent purity =98.5% chemical name or material 1 hexyne , 3, 4 dihydro 2h pyran 500ml density 0.926 ph 7.0 melting point 70°c boiling point 85°c to 86°c flash point 15°c ( 5°f ) odor unpleasant un number un2376 beilstein 103493 refractive index 1.442 pack size 500ml solubility information miscible with water and chloroform. formula weight 84.12 percent purity > 99.5% chemical name or material 3, 4 dihydro 2h pyran , toluene p sulphonic acid 250gm merck index 14, 9533 formula weight 194.19 ( anhydrous ) percent purity =92% pack size 250g chemical name or material p toluenesulfonic acid sodium salt total quantity : 1...

Surat Municipal Corporation - Gujarat

30230971 "tender for procurement of laboratory chemicals, reagents, glasswares, plastics, etc., items." acetone, acetone ar, aluminium nitrate, aluminium oxide activated ( neutral ) , aluminium oxide activated ( acidic ) , aluminium oxide activated ( basic ) , ammonium chloride, ammonium ferrous sulphate, tetrabutylammonium hydroxide 25%, ammonium molybdate, 1 naphthol, diphenylamine, arsenic trioxide, brilliant green bile broth, lactose broth, macconkey agar, macconkey broth w neutral red, skimmed milk agar, ringer salt solution powder, nutrient broth, nutrient agar, yeast glucose chloramphenicol agar, violet red bile glucose agar w / o lactose, ammonium oxalate, iso amyl alcohol, calcium chloride fused, sodium acetate anhydrous, aniline, antimony trichloride, ascorbic acid, barium chloride, benzaldehyde, benzene, boric acid, buffer solution ( ph 4.01 ) , buffer solution ( ph 7.00 ) , buffer solution ( ph 10.01 ) , n butanol, calcium carbonate, calcium chloride dihydrated, calcium hydroxide, calcium oxide, calcium nitrate, iso octane, carbon disulphide, carbon tetrachloride, tlc silica 60 aluminum plate ( 20x20 ) ( 250 micron layer ) , chloroform, chromium trioxide, citric acid, hydrochloric acid ar, curcumin, conc. hydrochloric acid ampules n / 1, hydrochloric acid n / 10 sol, nitric acid ar, sulphanilic acid, ammonia solution 25%, cupric acetate, copper sulphate, succinic acid, cyclohexane, di chloro dimethyl silane ( dds ) , di methyl glyoxime, pera di methylamino benzaldehyde, di phenyl amine, di potassium hydrogen phosphate, di sodium hydrogen phosphate, dichloromethane, diethyl ether lr, diethyl ether, edta disodium salt, erichrome black t indicator, ethidium bromide, edta dipotassium salt, fehling b ( pottassium sodium tartrate ) , fehling a ( copper sulphate ) , ferric ammonium sulphate, ferric chloride, ammonium ferric citrate, ferrous sulphate, formaldehyde 37%, fromic acid, furfuraldehyde, glacial acetic acid, dextrose, glycerol, glycine, n hexane, hydrogen peroxide 30%, hydroxylamine hyldrochloride, iodine, iodine tri chloride, lead acetate trihydrate, magnasium chloride hexahydrate, magnasium oxide, magnasium sulphate, mercuric chloride, metaphosphoric acid, methanol, methyl isobutyl ketone, methyl orange, methyl red, methylene blue, neutral red indicator powder, nesslers reagent, ninhydrin powder, o phosphoric acid, para toluidine, ortho toluidine, p dimethyl amino benzaldehyde ( pdab ) , parafin oil ( mineral oil ) , perchloric acid 60%, petrolium ether ( 40 60 c ) , petrolium ether ( 40 60 c ) , petrolium ether ( 60 80 c ) , phenol, phosphomolybdic acid, picric acid, plaster of paris, potassium chloride, potassium ferrocyanide, potassium iodide, pottassium chloride, pottassium chromate, pottassium dichromate, pottassium dihydrogen phosphate, potassium ferricyanide, pottassium hydrogen phthalate, pottassium hydrogen phosphate ( k2hpo4 ) , pottassium hydroxide, pottassium permanganate, pottassium sodium tartrate, pottassium sulphate, pottassium thiocyanate, ph paper strip ( 6.5 to 10.0 ) , ph paper strip ( 0 to 14.0 ) , pottussium di hydrogen phosphate, tryptone soya agar, chromogenic coliform agar, agar powder, buffered pepton water, plate count agar, bacto peptone granular, pyridine, quinoline, resorcinol, p rosolic acid, silica gel, silica gel 60 200 mesh, silica gel 230 400 mesh chromatography, silver nitrate, sodium azide, sodium bicarbonate, sodium benzoate, sodium bisulphite, sodium borate, sodium carbonate anhydrous, sodium chloride, sodium deoxycholate, sodium dihydrogen o phosphate, sodium hydrosulphite, sodium hydroxide, sodium hypochlorite, sodium molybdate, sodium nitrate, sodium nitrite, sodium sulphate, sodium sulphite, sodium thiosulphate pentahydrate, tri sodium citrate, sodium tungstate, soluble starch, stannous chloride, succinic anhydride, sucrose, sulphuric acid a.r., sulphur powder, tartaric acid, thio barbituric acid ( tba ) , thymol blue indicator, trichloro acetic acid, toluene, tri fluro acetic acid ( tfa ) , uric acid, xylene, zinc acetate, zinc chloride, zinc oxide, zinc sulphate, glass syringe 10ml, syringe filter 13mm nylon 0.45µ, regernated cellulose membrane for hplc solvent 0.45µ 47mm, regernated cellulose membrane for hplc solvent 0.2µ 47mm, filter paper for hplc sample preparation 0.45µ; 47mm, whatman 41 filter paper 125mm circle, whatman 1 filter paper 125mm circle, acesulfame potassium, sacchrin 98%, ammonium purpurate, standard calcium solution 1000mg / l, standard magnasium solution 1000mg / l, potassium chloroplatinate ( k2ptcl6 ) , cobaltous chloride ( cocl3, 6h2o ) , azomethine h sodium salt ( 8 n 2 hydroxybenzylidene ) naphth 1 01 3.6 disulphonic acid, l ascorbic acid ( c6h8o6 ) , ammonium acetate, oxalic acid, isopropyl alcohol 99%, carminic acid, standard cadmium solution 1000mg / l, sulphanilamide, n 1 naphthyl ethylene diamine dihydrochloride, potassium nitrate, urea, sodium sulphite anhydrous, antimony 1000mg / l, chromotropic acid disodium, di sodium tetraborate decahydrate, devarda s alloy powder ar, mercuric iodide, aluminium potassium sulphate, mercuric thiocyanate, ferric nitrate, patton and reeder s reagent, di ammonium hydrogen phosphate, sodium fluoride, zirconium oxychloride octahydrate, silver suphate, trans 1, 2 diaminocyclohexane n, n, n, n tetracetic acid monohydrate, tisab total ionic strength buffer solution for fluoride electrode, triethanolamine, bromocresol green indicator, potassium dihydrogen orthophosphate, n, n diethyl p phenylenediamine, dioctyl sodium sulphosuccinate, ethylene glycol monobutyl ether, sodium arsenite, diethylene glycol, erichrome blue black r, sodium oxalate, fluoride standard 1000mg / l, ß sitosterol, cholesterol, rhodamine b, annatto, gram stain reagent kit, kit for adultration testing of milk ( skim milk powder ) , multi parameter water testing kit, salt testing kit, centrifuge tube conical bottom 15ml ( autoclavable ) , centrifuge tube conical bottom 50ml ( autoclavable ) , pasteur pipette 3ml, round magnetic stirring bar with pivot ring, magnetic retriver, test tube basket with cover 180x170x160mm, centrifuge tube round bottom 10ml screw cap, centrifuge tube round bottom 50ml screw cap, methanol ( hplc ) , hplc grade water, acetonitrile, stigmasterol, n hexane hplc, n heptane hplc, isopropyl alcohol ( gc ) , aspartame, sodium saccharin, sucralose, saccharin, benzoic acid, sorbic acid, acesulfame k, caffeine, tert butyl hydroquinone, riboflavin, thiamine hydrochloride, nicotinic acid, pyridoxine hydrochloride, cyanocobalamine, 37 component fame mix, beta – n – oxalyl l amino alanine boaa, o phthalaldehyde, 2 mercaptoethanol, burette 10ml capacity class a, burette 25ml capacity class a, burette 50ml capacity class a, volumetric pipette 1 ml capacity class a, volumetric pipette 2 ml capacity class a, volumetric pipette 5 ml capacity class a, volumetric pipette 10 ml capacity class a, volumetric pipette 25 ml capacity class a, volumetric flask with glass stopperd 10ml class b, volumetric flask with glass stopperd 20ml class b, volumetric flask with glass stopperd 0ml class 25 ml class b, volumetric flask with glass stopperd 50ml class b, volumetric flask with glass stopperd 100ml class b, volumetric flask with glass stopperd 250ml class b, volumetric flask with glass stopperd 500ml class b, volumetric flask with glass stopperd 1000ml class b, test tube 25x150, test tube 18 x 150, dishes, evaporating, flat bottom, with pour out, round bottom flask 500 ml, round bottom flask 1000 ml, round bottom flask 2000 ml, essential oil determination for oil heavier than water apparatus as per is 1797, essential oil determination for oil lighter than water apparatus as per is 1797, round bottom flask 250ml 24 / 29 neck, round bottom flask 500ml 24 / 29 neck, round bottom flask 1000ml 24 / 29 neck, bromine, deionised water ( < 2 tds < 5µs conductivity ) , durham s tube, columns, chromatography, plain with sintered disc, 10mm bore, columns, chromatography, plain with sintered disc, 30mm bore, funnels, plain, 60 angle, short stem, funnels, plain, 60 angle, short stem 50mm, funnels, plain, 60 angle, short stem 75mm, adapter, enlarging, interchangeable joints 24 / 29 to 19 / 26, adapter, enlarging, interchangeable joints 34 / 35 to 24 / 29, all glass filter holder 47mm, filtration assembly, tubes, culture, media, round bottom, with pp screw cap and liner 25 x 100, tubes, culture, media, flat bottom, with pp screw cap and ptfe liner 25 x 57, crucibles, without lid 69 x 45, crucible tong with bow stainless steel, 1.5 ml micro centrifuge tubes with cap, butyrometer for fat determination in milk, butyrometer for fat determination in skimmed milk, butyrometer for fat determination in cream, butyrometer for fat determination in curd, butyrometer for fat determination in butter, dropping bottle, oven gloves pair, beaker tong, karl fischer pyridine free 250ml, conductivity solution 1.41 ms / cm, total dissolved solids ( tds ) , dessicator plain, dessicator vacuum, reusable bottle top filter, buchner funnel autoclavable, filtering flask autoclavable, micro tips low retension 1 ml, micro tips low retension 0.2 ml, universal micro tip box 1 ml ( 96 place ) , universal micro tip box 0.2 ml ( 96 place ) , sample container pp / hdpe 100ml sterile, pipettor stand ( 5 per stand ) , rack for micro tu be 24 place, conical centrifuge tube rack 15ml and 50ml hold togather, flask stand, indicator tape for steam autoclave 1x 500", tough tags 1000 per pack, hand protector grip, ss lab jack 8"x8" size platform, autoclavable biohazard bags 12x24, ph electrode ±25mv resolution, refractive index calibration standard, sodium carbonate, safety glass for eye protection, nitrile gloves medium size, refence material ( sesame oil ) , refence material ( linseed oil ) , refence material ( karanja oil ) , refence material ( castor oil ) , refence material ( cottonseed oil ) , refence material ( mineral oil ) , refence material ( argemone oil ) , refence material ( termeric powder with lead chromate ) ...

Directorate Of Forensic Science - Gujarat

30196182 bids are invited for 2 4 di nitro phenyl hydrazine 250 , 4 4 dinitrobenzyl pyridine 25 , acetic acid lr 500 , acetone ar 2.5 , acetone lr 2.5 , agar agar powder 500 , ammonia solution ar 500 , ammonium acetate 500 , aniline lr 500 , barium chloridelr 500 , barium nitrate lr 500 , barium sulphate lr 500 , benzene lr 500 , benzene crystalized lr 500 , benzidine powderlr 100 , carbon disulfied 500 , cedarwood oil ar 100 , charcoal fine powder ar 500 , chloroform ar 2.5 , chromotopic acid ar 100 , cobalt nitrate lr 25 , crystal violet ar 100 , di ethyl ether ar 2.5 , di ethyl ether lr 2.5 , di methyl aniline lr 500 , di methyl formamide lr 500 , di methyl sulfoxide 500 , dichloro methane ar 500 , dimethyl formamide hplc 500 , diphenyl amine ar 250 , fast blue b (o dianisidine) ar 25 , fehling a 500 , fehling b 500 , ferrous sulfide (stick) lr 500 , glacial acetic acid lr 2.5 , glycerinear 500 , hexanear 2.5 , hplc grade water 1 , hydrogen peroxide lr l , immersion oil ar 30 , iodine ar 10 , iodine crystal lr 25 , iso propyl alcohol 2.5 , lab wash solution lr 5 , lead acetate ar 25 , mercuric bromide ar 25 , methanol ar 2.5 , methelene blue lr 100 , morine ar 5 , nano2 250 , napthathanil diazo blue b ar 100 , nitric acid lr 2.5 , pdcl2 25 , petroleum ether ar 500 , potassium chloride lr 250 , potassium iodidie 250 , potassium permanganate 500 , safranin lr 10 , selenous acid 25 , silver nitrate ar 250 , sodium 1 napthyl phosphate gr 5 , sodium carbonate ar 250 , sodium chloride lr 500 , sodium sulfite 500 , sodium sulphate lr 500 , starch soluble ar 500 , tetra ethylene pentamine 100 , triethanol amine 500 , zinc urenyl acetate ar 5 , zirconium nitrate 250 total quantity : 1...

Forests and Environment Department - Gujarat

28444646 bids are invited for ammonia solution 25% , charcoal activated , glacial acetic acid , ferroin indicator solution , copper sulfate as per is: 261 , ammonium ferrous sulphate hexahydrate , barium chloride as per is: 5288 , formaldehyde solution as per is: 3321 , silver sulfate , sodium azide , hexane , manganese sulfate monohydrate is:10535 , methyl orange , nitric acid as per is: 264 , oxalic acid as per is: 501 , potassium dichromate , silica gel as per is:3401 , sodium hydroxide is:252 , murexide or ammonium purpurate , hydrochloric acid as per is:265 , eriochrome black t , sodium sulphate as per is: 247 , sodium hypochlorite orsodium hypochlorite solution as per is:11673 , iso propylalcohol as per is: 2631 , sulphanilamide , potassiumpermanganate as per is:333 , mercuric sulphate ,potassium nitrate as per is:301 , diphenylcarbazide , leadcarbonate is:14305 , cadmium sulphate , sodium arsenite ,potassium bromate , potassium bromide as per is: 2797 ,potassium iodide as per is: 7163 , sodium chloride,analytical reagent as per is: 4408 , sodium thiosulphate asper is: 14781mse exemption for turnover yesstartup exemption for turnover yesbidder turnover*in case any bidder is seeking exemption from experience / total quantity : 220...

Department Of Education - Gujarat

24980560 tender form for supply of laboratory chemicals / glassware / plastic ware / laboratory apparatus / minor instruments, for the government school in kachchh : 1 student microscope : isi : eye pieces 10x & 15x, objective lens 10x & 45x 2 disssecting microscope : student monocular microscope model has standard set with two eye pieces 10x & 15x 3 test tube : 5 x 8 : borosilicate ( 100 ) 4 watch glass : 3 5 staining rack : wooden for six bottles 6 pre. slide : meiosis mitosis set of 17 7 cucurbita stem l.s / t.s 8 sunflower stem t.s., d.s. + p.s. 9 sunflower root t.s., d.s. + p.s. 10 sunflower leaf t.s., d.s. + p.s. 11 maize root t.s., d.s. + p.s. 12 maize leaf t.s., d.s. + p.s. 13 maize monocot stem t.s. class work material 14 aceto carmine : 100 ml 15 benedict solution : 500 ml 16 biuret : reagent : 125 ml 17 blotting paper 18 carnoys fluid : 250 ml 19 eosine solution : 125 ml 20 fehling : a : 500 ml 21 fehling : b : 500 ml 22 formaldehyde : 500 23 hydrochloric acid diluted : 500 24 iodine solution 500 ml 25 jenus green solution 100 ml 26 millons reagent 125 ml 27 potassium bisulphate 500 gm 28 saffranine solution : 125 ml 29 starch powder : 500 gm 30 sudan iii : 100ml 31 sulphuric acid diluted : 500 ml 32 bile salt : 100 gm 33 cobalt chloride paper 34 gentian violet : 100ml 35 methyl orange: 125ml 36 1 nepthol : 100gm 37 nitric acid dil : 500ml 38 phenol red solution : 100ml 39 phenolphthelene : 125ml 40 potassium chloride : 500gm 41 potassium dichromate : 500gm 42 potassium hydroxide:pellets:500gm 43 sodium chloride : 500 gm 44 sulpher : 500gm 45 sulpho salicylic acid : 250 ml 46 aceto methenol : 500 ml 47 cotton blue: 100 ml 48 lactophenol blue cotton : 100 ml 49 hydrogen sulphide solution : 500 ml 50 sp jar usnea 51 sp jar lichen 52 sp jar cycus chart 53 sp jar coral 54 sp jar jelly fish 55 sp jar sea anemone 56 sp jar honey bee 57 sp jar ascaries 58 sp jar tape worm 59 sp jar liver fluke 60 sp jar planneria 61 sp jar neries 62 sp jar millipede 63 sp jar cockroach 64 sp jar scorpion 65 sp jar unio 66 sp jar sea urchin 67 sp jar amphioxus 68 sp jar calotes 69 sp jar sponge 70 sp jar opuntia 71 sp jar orchid 72 sp jar cuscutta with host 73 ganongs respirometer 74 mortar pestle 75 rubber cork 76 beaker 250 ml : glass borosilicate 77 burette 25 ml : glass borosilicate 78 graduated pipette ; 1ml : borosilicate 79 graduated pipette ; 5ml : borosilicate 80 petri dish : plastic : 3 81 specimen tube : 20 x 3.5 cm 82 conical flask 250 ml : borosilicate 83 funnel : plastic : 3 84 burette stand : 8 x 5 24 85 completer : 8 x 5 24 86 wash bottle : 250 ml : plastic 87 methylene blue : srl / merck / bdh 88 leishmans stain : srl / merck / bdh 89 glacial acetic acid : srl / merck / bdh 90 sucrose : srl / merck / bdh 91 boric acid : srl / merck / bdh 92 potassium nitrate : srl / merck / bdh 93 magnesium sulphate : srl / merck / bdh 94 glycerine : srl / merck / bdh 95 distilled water : srl / merck / bdh 96 neutral litmus solution : srl / merck / bdh 97 universal indicator : srl / merck / bdh 98 vaseline : srl / merck / bdh 99 diphenylamine solution : srl / merck / bdh 100 acetone : srl / merck / bdh 101 petroleum ether : srl / merck / bdh 102 ethanol : srl / merck / bdh 103 calcium carbonate : srl / merck / bdh 104 sodium bicarbonate : srl / merck / bdh 105 benzene : srl / merck / bdh 106 urea : srl / merck / bdh ( 500gm ) 107 roberts solution : srl / merck / bdh 108 preserved specimen plastic mounted or embedded : liver wort 109 preserved specimen plastic mounted or embedded : moss 110 preserved specimen plastic mounted or embedded : pinus 111 preserved specimen plastic mounted or embedded : dryopteris 112 preserved specimen plastic mounted or embedded : mushroom 113 preserved specimen plastic mounted or embedded : lilliacease plant 114 preserved specimen plastic mounted or embedded : bryophyllum 115 preserved specimen plastic mounted or embedded : water hyacinth 116 preserved specimen plastic mounted or embedded : hydrilla 117 preserved specimen plastic mounted or embedded : opuntia 118 preserved specimen plastic mounted or embedded : agave 119 preserved specimen plastic mounted or embedded : ultricularia 120 preserved specimen plastic mounted or embedded : pisum sativum 121 preserved specimen plastic mounted or embedded : lathyrus 122 preserved specimen plastic mounted or embedded : prassiflora 123 preserved specimen plastic mounted or embedded : ascaris 124 preserved specimen plastic mounted or embedded : snail 125 preserved specimen plastic mounted or embedded : liverfluke 126 preserved specimen plastic mounted or embedded : bat 127 preserved specimen plastic mounted or embedded : scoliodon 128 lifehistory of anophelese / cutex / silkmoth 129 development stages of cockroach 130 lifehistory of butterfly / honey bee 131 modification of root / stem / leaf 132 all inflorescences 133 tapeworm 134 pearl oyster 135 sea horse 136 permanent slides of : bacteria 137 permanent slides of : paramecium 138 permanent slides of : euglena 139 permanent slides of : chlamydomonas 140 permanent slides of : volvox 141 permanent slides of : entamoeba 142 permanent slides of : budding of yeast 143 permanent slides of : rhlzopus 144 permanent slides of : epidermal peel with stomatas 145 permanent slides of : parenchyma / collenchymas / scelerenchyma 146 xylem / phloem 147 vessels 148 pollen germination 149 pollen germination on stigma 150 t.s. testis of any mammal 151 t.s. ovary of any mammal 152 t.s. blastula of any mammal 153 t.s. morula / gastrula of any mammal 154 t.s. bonet.s.cartilage 155 wm.hydra 156 malarial parasite in blood 157 charts rexine family fabaceae / liliaceae / solanaceae 158 pedigree charts rolling of tongue / widows peek / colourblindness 159 controlled pollination emasculation, bagging teachnique 160 malarial parasite life cycle 161 hiv life cycle 162 pollination by different agencles 163 tyoes of gynoeclum / placentation / aestivation 164 fabricated models with dissectible parts 165 human skeleton 166 chart human torso 167 chart heart 168 chart kidney 169 chart brain 170 chart eye 171 chart ear 172 chart lung 173 development of ovule of anglosperm 174 ts.dicot / monocot root / stem 175 test tube stand plastic 176 brush camel 177 bunsen burner 178 slide box 179 forceps 180 needle 181 measuring cylinder 182 scissors 183 glass : test tubes borosil box 184 glass : measuring cyclineder 10ml / 20ml 185 plastic : beakers 50 ml 186 plastic : beakers 100 ml 187 plastic : beakers 250 ml 188 plastic : beakers 500 ml 189 glass : conical flask 100 ml 190 glass : round bottom flask 250 ml 191 cover slips blue star box 192 glass : slides pack of 50 193 glass rod 194 digital balance 195 test tube brushes 196 test tube holder 197 test tube stand 198 wire guage 199 cork borer set 200 thermometers 201 plastic : measuring cylinders 10ml 202 measuring cylinders 203 tripod stand 204 spirit lamp brass 205 staining rack 206 droppers 207 fouchet reagent 500ml 208 seliwanoffs reagent 500ml 209 ph indicator paper, ph 2 11 & ph 7 9 set 210 cavity tile ( porcelain ) 211 gooch crucible with paforated bottom 212 mechanical sieve set brass 213 lugols iodine solution 214 sodium potassium tartrate 215 amylase 216 spirit or ethyl alcohol 500ml 217 secchis disc 218 filter paper packet 219 dropper 220 sodium hypobromite 221 sodium hydroxide 222 models dna / rna on board 10x15 223 slide box 224 glass cupboard 225 sp jar earthworm 226 sp jar grasshopper 227 sp jar leech 228 sp jar spider 229 sp jar crab 230 sp jar prawn 231 sp jar octopus 232 sp jar amphioxus 233 frog chart 234 tortoise chart 235 banyan roots 236 opuntia 237 avecinia chart 238 orchid 239 sp jar ground nut root nodules 240 sodium chloride : srl / merck / bdh 241 ph tablets / paper : srl / merck / bdh 242 eosine : srl / merck / bdh 243 development stages of frog 244 octopus 245 lizard 246 permanent slides of : spirogyra 247 permanent slides of : oscillatoria 248 electric water bath 249 electronic balance 250 mortar and pestle 251 cover slips blue star box 252 glass : slides pack of 50 253 cavity slides 254 cork borer set 255 dessicator 256 buffer solution ph4 & ph9 257 indicator solution 258 6 8 ph buffer tablet 259 models dna / rna on board 10x15 260 squamous epithelium t.s. class work material 261 stratified epithelium p.s. class work material 262 calliated epithelium p.s. class work material 263 columner epithelium p.s. class work material 264 areolar connective p.s. class work material 265 frog blood smear, p.s. class work material 266 human blood smear, p.s. class work material 267 hyline certilage p.s. class work material 268 straited muscle w.m. p.s. class work material 269 non straited muscle w.m. p.s. class work material 270 medulated nerve t.s. p.s. class work material 271 non medulated nerve t.s. p.s. class work material 272 hydrolyzing solution : 500ml 273 sp jar star fish 274 sulphosalycylic acid 275 preserved specimen plastic mounted or embedded : rohu 276 preserved specimen plastic mounted or embedded : frog 277 wash bottle 278 foreceps 279 hot plate / 1 a meter : 0 5 a 2 ac power source for sonometer 3 aluminium block with hook 4 balance digital, lc, 0.1gm ( 100mg ) imported. 5 balance physical ( cap. 250gm ) , 3 stone wood case 6 banana lead, banana to banana, ( non stackable ) 7 bar magnet 2 8 battery eliminator ( superior quality ) dc 2 12 v, 2 amp 9 beaker 250 ml : plastic 10 beaker 3 litter 11 bob with hook brass, dia 18mm 12 boyles law apparatus supplied without mercury 13 capillary tube , 4 cm, l 1.25 m, consumable 14 concave lens, dia 50mm, fl 15 15 concave lens, dia 50mm, fl 20 16 concave mirror, dia 50mm, fl 10 17 concave mirror, dia 50mm, fl 15 18 constant wire / resistance wire 100gm 19 convex lens, dia 50mm, fl 15 20 convex lens, dia 50mm, fl 20 21 convex mirror, dia 50mm, fl 10 22 convex mirror, dia 50mm, fl 15 23 copper calorimeter, size 3x2 ( in wooden box ) 24 copper connecting wire 50 m black 25 copper connecting wire 50 m red 26 daniel cell ( complete ) includes copper pot, empty porous pot & zinc rod 27 different bore 28 drawing board, ( superior quality soft wood ) 12x18 29 drawing pin 30 dropper 31 fortins barometer, life in years 2 32 galvanometer ( dc with stand ) 30 0 30, mo 65 superior 33 gas burner : life in years 2 34 glass prism, equilateral 60x60x60, 38mm ( routine quality ) , 1.5 35 glass slab ( english glass ) 75x50x12 mm ( ordinary quality ) 36 glycerine litter 37 grave sands apparatus, life in years 3 38 helical spring 39 horshe shoe magnet / u magnet ( routine quality ) 50mm 40 inclined plane with roller ( without weights ) 100mm with roller & pan, superior quality 41 42 leclanche cell ( complete ) includes filled porous pot, zinc rod & plastic jar 43 liquid for boyles law 44 magnetic needle ( 75mm ) with aluminium stand 45 magnifier ( metal frame ) 2 46 magnifier ( metal frame ) 4 47 metal balls small different diameters 48 metal cube aluminium, 25 mm 49 metal cylinder hollow set of 5 different diameter 50 metal cylinder set of 5 different diameter 51 meter bridge ( wheatstone bridge ) with pencll jockey ( sunmica base ) routine 52 meter scale, one meter, routine quality 53 micro a meter 54 milli ammeter, dc range 0 100 ma 55 milli ammeter, dc range 0 250 ma 56 milli ammeter, dc range 0 50 ma 57 milli ammeter, dc range 0 500 ma 58 milli volt meter, dc range 150 mv 59 milli volt meter, dc range 250 mv 60 milli volt meter, dc range 500 mv 61 mirror strip, 4x1, with plastic stand. 62 multi meter, digital ( imported ) , super quality 63 newton law of cooling, school pattern, g.i.sheet 64 optical bench ( metal double rod ) iron rod, 1 meter long heavy 65 optical needle ( parallax pin ) 100mm iron, cp 66 p n junction diod apparatus, superior, only printed board 67 pencil jockey 68 physical weight box brass cp, 1gm to 100gm 69 plane mirror, consumable 70 plug key one way with brass block 71 plug key two way with brass block 72 plum bob 73 potentiometer, one meter long wooden board quipped with brass strips on sunmica base 4 wire with pencil jockey, routine 74 resistance box 1 to 1000 ohm, s.q. 75 resistance box, ( brass ) plug type, constant coil, 9mm thick brass block, 1 100 ohm, superior quality 76 resistance box, 1000 ohms 77 resistance coil ( round bakelite case ) 1 100 ohm 78 resonance tube apparatus, 25 mm, ss 79 reversable key 80 rheostat ( brass rod ) , 15cm, 4.3 cm dia tube 81 rheostat 8:0.5 a 82 rubber / cork butch 83 rubber pad 84 screw driver : life in years 1 85 screw gauge ( micrometer ) ss rod micrometer 25 mm 86 slotted weight : 2.5 kg 87 slotted weight : 5 x 500 gm 88 sono meter, soft wood, ( aluminium feeting ) 89 sono meter, wooden support 90 spherometer, brass double disc, heavy pattern ( superior ) 91 spirit level, 6, plastic 92 spring balance, tubular acrylic, 1000gm 93 stop watch digital, 100sec, routine quality 94 string reel 95 thermometer ( 30cm length ) , 10 360 celcious, mercury 96 thermometer ( faranhit ) , 30 to 110 c, alchohol 97 transistor characteristic apparatus, pnp or npn, with four meter, only wooden board type required 98 travelling microscope, lc, 0.01 mm, 2 motions, in wooden box 99 tripot stand, 7x4 100 tunning fork, welnch type tuning fork with pad in welwet case 101 unknown resistance board on wooden 102 v shape stand, wooden 103 venturi tube 104 vernier calliper, wheel type, 12 cm, stainless steel 105 viscosity apparatus with metal stand, glass tube with rubber, cork and thistle funnel 106 wolt meter ( mo 65 ) , round dial dc with stand, range 0 12 v 107 wolt meter ( mo 65 ) , round dial dc with stand, range 0 5 v 108 younges modulus : vernier type 109 zener diod apparatus, superior, only printed board 110 stand ( with clamp ) 111 set square 112 spring balance, digital 113 rheostate 100 ohm 114 rheostate 500 ohm 115 rheostate 50 ohm 116 rheostate 20 ohm 117 resistance box 50 ohm 118 resistance box 10 ohm 119 voltmeter 0 1 volt 120 voltmeter 0 15 volt 121 voltmeter 0 12 v 122 micro a meter 0 100 microa 123 micro a meter 0 500 microa 124 a meter : 0 20 ma 125 physical weight box brass cp, 1gm to 200gm 126 rheostate 1000 ohm 127 resistance box 0 10000 ohm / 1 wash bottle plastic 500ml 2 beaker borosilicate 100ml 3 beaker 250ml borosilicate 4 beaker 1000 ml plastic 5 conical flask 100 ml 6 conical flask 250 ml borosilicate 7 tripod stand heavy 6 x 4 triangle containton 8 evaporating dish 3 div 9 test tube stand pvs with 6 test tube capacity 10 test tube holder 11 test tube 5 x 5 / 8 ( 100 ) borosilicate box ( 10 ml ) 12 burette poly plastic 25 ml 13 pipette 10 ml borosilicate 14 crusible tongs 8 15 burette stand completer ( 8x5x24 ) 16 spectula s.s. 6 17 volumatric flask 250 ml borosilicate 18 burner with stop cock 19 wire gauge asbestose with frame 20 reagent bottle 250 ml nm 21 reagent bottle 500 ml ac 22 reagent bottle 250 ml wm 23 claypipe triangle 2 24 glass road 15 cm 0.5 mm 25 dropper with teat for reagent bottle ( 250 blue 6 long ml ) special dropped with safely 26 ele. digital balance 200 gm cape + 0.001 self calibration 27 copper metal foil 500 gm 28 ferric nitrate 500 gm 29 hydrochloric acid 2.5 ltr 30 methyl orange 100 ml 31 p.h. paper 100 lrs box 32 ammonium salt 500 gm 33 sodium bicarbonate 500gm 34 sodium carbonate 500gm 35 sodiyum hydroxide flakes 500 gm 36 sulphuric acid 2.5 ltr 37 tartaric acid 500 ml 38 sodium salt 500 gm 39 ammonium phospet di 500 gm 40 ammonium sulphate 500 gm 41 barium carbonate 500 gm 42 barium chloride 500 gm 43 barium nitrate 500 gm 44 cadmium chloride 100 gm 45 copper chloride 500 gm 46 copper nitrate 500 gm 47 copper sulphate 500 gm 48 ferric chloride 500 gm 49 ferrous sulphate 500 gm 50 ferrous sulphide 500 gm 51 filter paper whatman paper 40 no. big box 1 52 lead acetate 500 gm 53 lead carbonate 500 gm 54 lead nitrate 500 gm 55 lead paroxide 500 gm 56 liquid ammonia 500 ml 57 magnesium carbonate 250 gm 58 magnesium chloride 500 gm 59 magnesium sulphate 500 gm 60 manganese chloride 500 61 manganese dioxide 500 62 mercuric chloride 250 gm 63 picric acid 500 gm 64 potassium bromide 500 gm 65 potassium carbonate 500 gm 66 potassium chloride 500 gm 67 potassium chromate 500 gm 68 potaasium dichromate 500 gm 69 potassium ferrocynide 500 gm 70 potassium ferricynide 500 gm 71 potassium iodide 500 gm 72 potassium nitrate 500 gm 73 potassium permenganate 500 gm 74 potassium pyrontimonate 50 gm 75 potassium sulphate 500 gm 76 potassium phosphate 500 gm 77 silver nitrate 25 gm 78 sodium bromide 500 gm 79 di sodium hydrogen phospet 500 gm 80 sodium metal 250 gm 81 sodium phospet 500 gm 82 tin chloride 250 gm 83 zinc carbonate 500 gm 84 zinc chloride 500 gm 85 zinc dust 500 gm 86 zinc nitrate 500 gm 87 zinc sulphate 500 gm 88 aluminium sulphate 500 gm 89 cadmium nitrate 100 gm 90 copper oxide 100 gm 91 di phynyl amine 250 gm 92 ferrous ammo.sulphate 500 gm 93 methyl acetate 500 ml 94 methylene blue 100 ml 95 potassium oxalate 500 gm 96 acetamide 500 gm 97 acetophenone 500 ml 98 acetone 500 ml 99 ammonium acetate 500 gm 100 ammonium chloride 500 gm 101 aniline 500 ml 102 benzaldehyde 500 ml 103 benzamide 500 gm 104 benzene 500 ml 105 benzoic acid 500 gm 106 chloro benzene 500 ml 107 dextrose 500 gm 108 metadinitro benzene 500 gm 109 napthelene 500 gm 110 nesslers reagent 100 ml 111 nitro benzene 500 ml 112 pera toludine 500 ml 113 phenol 500 gm 114 pthelic anhydride 500 gm 115 potassium iodate 100 116 resorcinol 500 gm 117 cobalt nitrate 100 gm 118 sodium nitro pruside 100 gm 119 toluene 500 ml 120 urea 500 gm 121 zinc sulphide 500 gm 122 thermometer 360 degree + 1 degree c. mercury 123 nitric acid 2.5 ltr 124 cloroform 500 ml 125 methanol 500 ml 126 sodium cobalt nitrate 500 gm 127 ethanol 500 ml 128 digital ph meter 0 14 ph : auto temp. conponsetion with combinelectode 129 burner pipe 10 meter 130 sodium sulphide flakes 500gm pure 131 benzyl alchole 500 ml 132 beaker 5000 ml plastic 133 beaker 100 ml plastic 134 beaker 250 ml plastic 135 beaker 2000 ml plastic 136 beaker 500 ml plastic 137 capillary tube 138 funnel plastic 139 funnel glass 140 measuring cylinder 100 ml 141 measuring cylinder 250 ml 142 rubber cork 143 spirit lamp ( brass ) 144 test tube brush 145 tiles white 146 agar agar 100 gm 147 aluminium chloride 500 gm 148 ammonium carbonate 500 gm 149 ammonium cerric nitrate 100 gm 150 ammonium molybdate 500 gm 151 blue and red litmus paper box 152 borax 500 gm 153 bromine water 500 ml 154 calcium carbide 500 gm 155 calcium carbonate 500 gm 156 calcium hydroxide 500 gm / ml 157 calcium oxide 500 gm 158 calcium sulphate 500 gm 159 calcium nitrate 500 gm 160 carbon disulphide 500 gm 161 charcoal 500 gm 162 chlorine water 500 ml 163 chromatography paper box 164 calcium chloride 500 gm 165 dimethyl glyoxime 100 ml 166 distilled water 100 ltr 167 fehling sollution a 500 ml 168 fehling sollution b 500 ml 169 glacial acetic acid 2.5 liter 170 iodine 100 gm 171 magnessium ribbon 100 gm 172 manganese sulphate 500 gm 173 mohrs salt 500 gm 174 nesslers reagent 500 ml 175 oxalic acid 500 gm 176 phenophthalein 100 ml 177 potash alum 500 gm 178 potassium aluminium sulphate 500 gm 179 red litmus paper box 180 red litmus solution set and blue litmus solution set 181 sodium nitrate 500 gm : nano3 182 sodium nitrate 500 gm : nano2 183 sulphur powder 500 gm 184 tin metal 100 gm 185 zinc acetate 500 gm 186 zinc bromide 500 gm 187 zinc granules 100 gm 188 ammonium oxalate 500 gm 189 1 napthol 500 gm 190 2 napthol 500 gm 191 p toludine 500 gm 192 ammonium sulphide ( yellow ) 500 gm 193 acetaldehyde 500 gm 194 acetyle chloride 500 ml 195 amyl alcohol 500 ml 196 arsenic oxide 500 gm 197 benedict reagent 500 ml 198 a nephthol 500 gm 199 b nephthol 500 gm 200 p toluedene 500 gm 201 nickel sulphate 500 gm 202 2 , 4 dinitro phenyle hydrezene 500 ml 203 carbon tetra chloride 500 ml 204 ammonium bromide 500 ml 205 di ethyle ether 206 ninhydrene 500 ml 207 potessium bicarbonate 500 gm 208 ether 500 ml 209 piredene 500 ml 210 schiff reagent 500 ml 211 sodium thiosulphate 500 ml 212 starch 500 gm 213 tollens reagent 500 ml 214 urenyle zinc acetate 5gm 215 zinc nitrate 500 gm 216 mangenise sulphide 500 gm 217 stop watch 218 lucas reagent 500 ml 219 dioxane 500 ml 220 naocl ( sodium hypo chloride ) 500 ml 221 aniline hydro chloride 500 ml 222 di azo amino benzene 500 ml 223 barfod reagent 500 ml 224 selivanoff reagent 500 ml 225 paraffin 500 ml 226 hydrogen peroxide 200gm 227 gum 200ml 228 water tank 20 ltr 229 cobalt sulphide 500gm 230 platinum wire 231 fusion tube 1 box 232 rubber tube 1mtr 233 sodium iodide 500gm 234 cobalt oxide 500gm 235 barium carbonate 500gm 236 lime water 500ml 237 ammonium cerric nitrate 500 gm 238 potassium iodate 100 gm 239 benedict reagent 250 ml 240 ninhydrene 100 ml 241 kcns 500gm 242 plastic tin ( 10lit ) 243 paraffin 500ml 244 universal indicator 500ml...

Surat Municipal Corporation - Gujarat

24665459 tender for procurement oflaboratory chemicals, reagents,glasswares, plastics, etc., items 1 23/001/0001/00/0/0/0 alberts stain a solution (metachrometic) 125ml 2 23/001/0002/00/0/0/0 alberts stain b solution (metachrometic) 125 3 23/001/0003/00/0/0/0 eosin 2% liquid (ready to use & bsc certified ar) 100ml 4 23/001/0004/00/0/0/0 gention violet solution 100ml 5 23/001/0005/00/0/0/0 gms iodine solution 100 ml 6 23/001/0006/00/0/0/0 carbol fuchsine for afb stain strong 500ml 7 23/001/0007/00/0/0/0 hematoxylene (harris) liquid (ready to use & bsc certi. ar 100ml 8 23/001/0009/00/0/0/0 giemsa stain solution(ready to use prefer with buffer&bsc cert 100ml 9 23/001/0010/00/0/0/0 lugols iodine 100ml 10 23/001/0014/00/0/0/0 safranine solution 100 ml 11 23/001/0015/00/0/0/0 silver nitrate solution 10% 500ml 12 23/001/0016/00/0/0/0 30% sulphosalicylic solution analytical grade 500ml 13 23/001/0017/00/0/0/0 c.s.f.diluting fluid 100ml 14 23/001/0018/00/0/0/0 acetone powder (detection) 100 gm 15 23/001/0019/00/0/0/0 tuberculin p.p.d. (10tu/0.1ml) 5ml vial 16 23/001/0025/00/0/0/0 liquid detergent for lab purpose ( labolene ) 5 jar 17 23/001/0026/00/0/0/0 leishman stain solu(cytochromic)ready to use bufer bsc cert 500ml 18 23/001/0027/00/0/0/0 n/10 hydrochloric acid for hb estimation 500ml 19 23/001/0028/00/0/0/0 wbc diluting fluid 500ml 20 23/001/0030/00/0/0/0 22% bovine albumin vial of 5 ml 21 23/001/0031/00/0/0/0 coombs serum ( anti human serum) 5ml 22 23/001/0033/00/0/0/0 fouchests reagent 500ml 23 23/001/0034/00/0/0/0 r.b.c. diluting fluid 500ml 24 23/001/0035/00/0/0/0 benedicts qualitative solution 1000ml 25 23/001/0037/00/0/0/0 pow.glucose analytical grade 500gm 26 23/001/0039/00/0/0/0 semen diluting fluid 100ml 27 23/001/0040/00/0/0/0 drabhkins solution with cynamath hb. standard vial (5 liter jar) 28 23/001/0041/00/0/0/0 nutrient agar (bacteriologial media) 500gm 29 23/001/0042/00/0/0/0 macconkeys agar (bacteriologial media) 500gm 30 23/001/0049/00/0/0/0 eharlichs aldehyde reagent 100 ml 31 23/001/0050/00/0/0/0 ph paper 2 to 10.5 100 nos. 32 23/001/0051/00/0/0/0 tissue paper roll (48x2ply. 10cmx96mtr.) 33 23/001/0055/00/0/0/0 acid alcohol for afb stain 100 ml 34 23/001/0056/00/0/0/0 reticulocyte counting fluid(ready to use&bsc certiar) 25ml 35 23/001/0057/00/0/0/0 brillient crysyl blue dye powder dch.stain 25 gm 36 23/001/0059/00/0/0/0 aec diluting fluids 100ml 37 23/001/0060/00/0/0/0 ordinary filter paper sheet (standard size) 38 23/001/0061/00/0/0/0 calcium chloride reagent for aptt 10ml 39 23/001/0062/00/0/0/0 fixative spray for cytology 50ml 40 23/001/0065/00/0/0/0 blood group sera anti a monoclonal 10ml 41 23/001/0066/00/0/0/0 blood group sera anti b monoclonal 10ml 42 23/001/0067/00/0/0/0 blood group sera anti d monoclonal igm 10ml 43 23/001/0068/00/0/0/0 blood group sera anti d (polyclonal igm+igg) 10ml 44 23/001/0072/00/0/0/0 calibrater for biochem(human sera based for chemistry,hormons,tumor 45 23/001/0073/00/0/0/0 control for biochem(human sera base for chemistry, hormone,tumor levl1 46 23/001/0074/00/0/0/0 control for biochem(human sera base for chemistry, hormone,tumor levl2 47 23/001/0085/00/0/0/0 3.8% sodium citrate solution 500ml 48 23/001/0086/00/0/0/0 seliwanott fructose reagent 100ml 49 23/001/0088/00/0/0/0 control for biochem(human sera base for chemistry, hormone,tumor levl3 50 23/001/0089/00/0/0/0 bovine albumin flakes 5 gm 51 23/001/0092/00/0/0/0 anaerobic gas pack sachet box of 5 packets 52 23/001/0093/00/0/0/0 iron alum 100 gm 53 23/001/0095/00/0/0/0 activated charcoal 500 gm 54 23/001/0098/00/0/0/0 d.p.x.mount(cleanar) 250ml 55 23/001/0101/00/0/0/0 ethanol absolute 500ml 56 23/001/0102/00/0/0/0 calibrator for ck mb human sera based 5ml 57 23/001/0103/00/0/0/0 o cell (o cell prepared in liss solution) 10 ml 58 23/001/0104/00/0/0/0 indian ink 100 ml 59 23/001/0107/00/0/0/0 methylene blue powder 25gm 60 23/001/0108/00/0/0/0 deoxycholate citrate agar 100 gms 61 23/001/0109/00/0/0/0 lowenstein jensen medium 100 gms. 62 23/001/0110/00/0/0/0 paraffin liquid (for lab purpose) 500ml 63 23/001/0112/00/0/0/0 nutrient broth 100 gms. 64 23/001/0113/00/0/0/0 oxidation fermentation basal media 100 gms. 65 23/001/0114/00/0/0/0 roberson cook meat medium 500 gms. 66 23/001/0115/00/0/0/0 thioglycollate medium 100 gms. 67 23/001/0116/00/0/0/0 viral transport medium 3ml vtm in 15ml tube with 2 viscos swabs 68 23/001/0117/00/0/0/0 sulphuric acid concentrated analytical grade 500ml 69 23/001/0119/00/0/0/0 tcbs agar 100gm 70 23/001/0121/00/0/0/0 thayer martin medium base with suppliments 100gm 71 23/001/0122/00/0/0/0 alkaline peptone water 100 gms. 72 23/001/0124/00/0/0/0 gentian violet powder 100 gms. 73 23/001/0125/00/0/0/0 triple sugar iron agar 100gm 74 23/001/0126/00/0/0/0 urea solution 40% (5ml/vial) 75 23/001/0127/00/0/0/0 urea agar base (christensen autoclavable) 100gm 76 23/001/0130/00/0/0/0 yeast extract powder 500 gm 77 23/001/0142/00/0/0/0 phenol red dextorose broth 100gm 78 23/001/0143/00/0/0/0 phenol red lactose broth 100gm 79 23/001/0144/00/0/0/0 phenol red mannitol broth 100gm 80 23/001/0145/00/0/0/0 phenol red maltose broth 100gm 81 23/001/0146/00/0/0/0 phenol red sucrose broth 100gm 82 23/001/0147/00/0/0/0 ornithine decarboxylase broth 100gm 83 23/001/0149/00/0/0/0 arginine decarboxylase broth 100gm 84 23/001/0151/00/0/0/0 edta analytic grade 100 gm 85 23/001/0152/00/0/0/0 ferrous ammonium sulphate a.r (fe(nh4)2 so4) analytic grade 500 gm 86 23/001/0153/00/0/0/0 hydrogen peroxide (h2o2) analytic grade 100 gm 87 23/001/0158/00/0/0/0 uric acid analytic grade 100 gm 88 23/001/0159/00/0/0/0 fructose powder 500 gm 89 23/001/0161/00/0/0/0 iodine powder lr 100gm 90 23/001/0162/00/0/0/0 pottassium iodide analytical grade 100gm 91 23/001/0171/00/0/0/0 sodium dihydrogen orthophosphate nah2po4 2h2o (500 gms.) 92 23/001/0172/00/0/0/0 disodium hydrogen orthophosphate na2hpo4 (500 gms.) 93 23/001/0174/00/0/0/0 oxacillin (1 micro gram) 94 23/001/0175/00/0/0/0 vancomycin 30mcg (individual antibiotic disc) 95 23/001/0176/00/0/0/0 imipenam 10mcg (individual antibiotic disc) 96 23/001/0177/00/0/0/0 amikacin 30mcg (individual antibiotic disc) 97 23/001/0178/00/0/0/0 amoxy clav 30mcg (individual antibiotic disc) 98 23/001/0179/00/0/0/0 ammonia solution concetrated(nh4oh) analytical grade 500ml 99 23/001/0181/00/0/0/0 periodic acid 10gms. 100 23/001/0182/00/0/0/0 thymol crystals analytical grade 25gm 101 23/001/0183/00/0/0/0 bacitracin 102 23/001/0185/00/0/0/0 colistin 103 23/001/0188/00/0/0/0 succinic acid lr 500gm 104 23/001/0192/00/0/0/0 optochin 105 23/001/0194/00/0/0/0 phenol crystal 500ml 106 23/001/0195/00/0/0/0 picric acid analytical grade 500ml 107 23/001/0197/00/0/0/0 silver nitrate powder analytical grade (ar) 25gm 108 23/001/0198/00/0/0/0 safranine powder 25gm 109 23/001/0200/00/0/0/0 sodium sulphate anhydrous analytical grade 500gm 110 23/001/0203/00/0/0/0 sodium acetate (anhydrous) analytical grade 500gm 111 23/001/0206/00/0/0/0 sudan black 25gm 112 23/001/0207/00/0/0/0 toluedine blue 100ml 113 23/001/0208/00/0/0/0 trichloro acetic acid analytical grade (ar) 500 gm 114 23/001/0211/00/0/0/0 phenol a.r 500gm 115 23/001/0212/00/0/0/0 sulphanilic acid analytical grade (ar) 100gm 116 23/001/0213/00/0/0/0 iodine pellet 100gm for stain preparation 117 23/001/0215/00/0/0/0 pottassium hydroxide pellet analytical grade 100gm stain prepatration 118 23/001/0216/00/0/0/0 nahco3 powder analytical grade 500 gm 119 23/001/0218/00/0/0/0 hi chrom candida diffentrial agar,for mycology dept. 100gm 120 23/001/0231/00/0/0/0 methanol 2500ml 121 23/001/0234/00/0/0/0 ferric chloride anhydrous powder analytical grade 250gm 122 23/001/0235/00/0/0/0 acetic acid (glacial) 500ml 123 23/001/0237/00/0/0/0 potassium permangenate ar (kmno4) powder 500gm 124 23/001/0239/00/0/0/0 gram +ve multidiscs 12 antibiotics 125 23/001/0240/00/0/0/0 gram ve multidiscs 12 antibiotics 126 23/001/0241/00/0/0/0 urinary isolates multidiscs 12 antibiotics 127 23/001/0242/00/0/0/0 antibiotic discs for pseudomonas 12 antibiotics 128 23/001/0244/00/0/0/0 benzidine powder analytical grade 100gm 129 23/001/0246/00/0/0/0 heamtoxyline powder 100gm 130 23/001/0247/00/0/0/0 mgg powder 100 gm 131 23/001/0250/00/0/0/0 sodium metabisulphite 500gm 132 23/001/0254/00/0/0/0 tuberculin p.p.d. 5tu/0.1ml 5ml vial 133 23/001/0259/00/0/0/0 polymyxin b 300 units,required in units measurement 134 23/001/0261/00/0/0/0 tuberculin p.p.d. (1tu/0.1ml) 5ml vial 135 23/001/0263/00/0/0/0 methylene blue solution 100ml 136 23/001/0264/00/0/0/0 sterile swab with plastic stick 137 23/001/0265/00/0/0/0 sterile swab with plastic stick with plastic tube 138 23/001/0266/00/0/0/0 polymyxin b 50mcg. 139 23/001/0271/00/0/0/0 spirit lamp 140 23/001/0272/00/0/0/0 n.n.n.n. tetramethyl paraphenyline diamyne dihydrochloride 5gm 141 23/001/0273/00/0/0/0 mr vp medium 100gm 142 23/001/0274/00/0/0/0 test tube rack alu.(15mm dia.hole size)(12x4 tube cap.) 143 23/001/0275/00/0/0/0 horse serum (100ml/vial) (use in loeflers medium base) 144 23/001/0277/00/0/0/0 potassium tellurite 1% (1ml/vial) 145 23/001/0284/00/0/0/0 test tube stand for test tube of 40mm diameter, 150mm 146 23/001/0297/00/0/0/0 rhodamine b 25gm 147 23/001/0298/00/0/0/0 barium choride (bacl2) powder analytical grade 500gm 148 23/001/0300/00/0/0/0 aniline ar 500 ml 149 23/001/0302/00/0/0/0 neutral red powder 100gm 150 23/001/0312/00/0/0/0 tween 80 analytical grade 500ml 151 23/001/0384/00/0/0/0 sterile tris edta (te) buffer (1x). 152 23/001/0400/00/0/0/0 ethidium bromide ar 1gm 153 23/001/0408/00/0/0/0 indicator strip for autoclave (quality control) pkt 25 nos. 154 23/001/0411/00/0/0/0 lab sealing film suite for all purpose parafilm 2x 250ft.(1dia.core) 155 23/001/0434/00/0/0/0 tissue embedding medium (use for frozen section in cryostate) 100ml 156 23/001/0435/00/0/0/0 microscope bulb (focus line) 12v 50w 157 23/001/0436/00/0/0/0 alcohol (molecular) diluents for rna extraction 500ml 158 23/001/0442/00/0/0/0 white saponin powder 500 gm 159 23/001/0450/00/0/0/0 sodium hydrosulfite (0.4) 500gm 160 23/001/0451/00/0/0/0 fields stain a 500ml 161 23/001/0452/00/0/0/0 fields stain b 500ml 162 23/001/0453/00/0/0/0 anti sera for vibrio cholera poly 01 163 23/001/0454/00/0/0/0 anti sera for vibrio cholera ogawa 164 23/001/0455/00/0/0/0 anti sera for vibrio cholera inaba 165 23/001/0456/00/0/0/0 anti sera for vibrio cholera o 139 166 23/001/0457/00/0/0/0 anti sera for salmonella spp poly o 167 23/001/0458/00/0/0/0 anti sera for salmonella spp o 9 168 23/001/0459/00/0/0/0 anti sera for salmonella spp h d 169 23/001/0460/00/0/0/0 anti sera for salmonella spp h a 170 23/001/0461/00/0/0/0 anti sera for salmonella spp h b 171 23/001/0462/00/0/0/0 anti sera for salmonella spp v i 172 23/001/0463/00/0/0/0 basic fusching powder 500gm 173 23/001/0472/00/0/0/0 furfuraldehyde liquid ar 500ml 174 23/001/0476/00/0/0/0 orthophosphoric acid powder 500gm 175 23/001/0477/00/0/0/0 giemsa powder ( bsc certified ar) 500gm 176 23/001/0509/00/0/0/0 disposable s.s. microtome blade for leica microtome rm2255 box of 35no 177 23/001/0525/00/0/0/0 cefoxitin 30mcg (individual antibiotic disc) 178 23/001/0526/00/0/0/0 cefazolin 30mcg (individual antibiotic disc) 179 23/001/0527/00/0/0/0 cefuroxime 30mcg (individual antibiotic disc) 180 23/001/0528/00/0/0/0 teicoplanin 30mcg (individual antibiotic disc) 181 23/001/0529/00/0/0/0 linezolid 30mcg (individual antibiotic disc) 182 23/001/0530/00/0/0/0 levofloxacin 5mcg (individual antibiotic disc) 183 23/001/0531/00/0/0/0 erythromycin 15mcg (individual antibiotic disc) 184 23/001/0532/00/0/0/0 ampicillin 10 units (individual antibiotic disc) 185 23/001/0533/00/0/0/0 co trimoxazole 25mcg (individual antibiotic disc) 186 23/001/0534/00/0/0/0 gentamicin 10mcg (individual antibiotic disc) 187 23/001/0535/00/0/0/0 piperacillin/tazobactam 100/10mcg (individual antibiotic disc) 188 23/001/0536/00/0/0/0 tobramycin 10mcg (individual antibiotic disc) 189 23/001/0537/00/0/0/0 norfloxacin 10mcg (individual antibiotic disc) 190 23/001/0538/00/0/0/0 lomefloxacin 10mcg (individual antibiotic disc) 191 23/001/0539/00/0/0/0 gatifloxacin 5mcg (individual antibiotic disc) 192 23/001/0540/00/0/0/0 nitrofurantoin 300mcg (individual antibiotic disc) 193 23/001/0541/00/0/0/0 tetracycline 30mcg (individual antibiotic disc) 194 23/001/0542/00/0/0/0 netilin 30mcg (individual antibiotic disc) 195 23/001/0543/00/0/0/0 ceftizoxime 30mcg (individual antibiotic disc) 196 23/001/0544/00/0/0/0 meropenem 10mcg (individual antibiotic disc) 197 23/001/0548/00/0/0/0 copper acetate (analytical grade) 500 gm 198 23/001/0549/00/0/0/0 diethyl ether ar 2500ml 199 23/001/0550/00/0/0/0 peptone (bactoriological) 500 gm 200 23/001/0557/00/0/0/0 agarose powder (molecular grade) 100gm 201 23/001/0561/00/0/0/0 boric acid analytical grade (ar) 500gm 202 23/001/0562/00/0/0/0 tris (hydroxymethyl amino methane) (analytical grade) 500gm 203 23/001/0567/00/0/0/0 sodium sulphite ar (analytical grade) 500gm 204 23/001/0571/00/0/0/0 acrylamide 205 23/001/0575/00/0/0/0 may grunwald powder, ar (bsc certified) 100 gm 206 23/001/0586/00/0/0/0 factor viii deficient plasma 5x1 ml 207 23/001/0587/00/0/0/0 red cell preservative solution (20ml vial) 208 23/001/0600/00/0/0/0 bile salt a.r. 100 gm. 209 23/001/0601/00/0/0/0 fructose powder a.r. 500 gm. 210 23/001/0602/00/0/0/0 gelatine a.r. 500 gm. 211 23/001/0606/00/0/0/0 starch (soluble) a.r. 500 gm. 212 23/001/0607/00/0/0/0 control for tti testing 213 23/001/0608/00/0/0/0 control for gel card (of ict) 214 23/001/0614/00/0/0/0 capsule stain, for capsule staining of bacteria 100 ml 215 23/001/0615/00/0/0/0 spore stain kit, for spore staining of bacteria, kit of 100 ml 216 23/001/0616/00/0/0/0 macfarlands standard 0.5,for antimicrobial sensitivity test,set 5 tube 217 23/001/0617/00/0/0/0 spirochaetes stain/fontana stain, kit of 200 ml 218 23/001/0620/00/0/0/0 ertrapenam antibiotic disc,antibio. disc individul with content 10mcg 219 23/001/0621/00/0/0/0 ceftazidime/clavulanic acid antibiotic disc 220 23/001/0622/00/0/0/0 chloramphenicol antibiotic disc,individual with content 30mcg 221 23/001/0623/00/0/0/0 tigecycline antibiotic disc individual with content 15mcg 222 23/001/0624/00/0/0/0 nitrate disc for nitrate reduction test 223 23/001/0625/00/0/0/0 bile esculine disc for detection of esculin hydrolisis 224 23/001/0626/00/0/0/0 mrsa chrome agar base 500gms,for detection of mrsa 225 23/001/0627/00/0/0/0 meresa selective suppliment, for preparation of mrsa agar 226 23/001/0628/00/0/0/0 cefoxitin suppliment, for preparation of mrsa agar 227 23/001/0629/00/0/0/0 serum controls for ra latex, for quality control,vial of 0.5ml 228 23/001/0630/00/0/0/0 serum controls for aso latex, for quality control,vial of 0.5ml 229 23/001/0631/00/0/0/0 serum controls for crp latex, for quality control,vial of 0.5ml 230 23/001/0632/00/0/0/0 serum controls for rpr, for quality control,vial of 0.5ml 231 23/001/0633/00/0/0/0 serum controls for widal, for quality control, of 0.5ml 232 23/001/0634/00/0/0/0 external positive control for syphilis 233 23/001/0635/00/0/0/0 factor ix ( kitof 6 x 1 ml) 234 23/001/0636/00/0/0/0 acesulfame potassium ar 25gm 235 23/001/0637/00/0/0/0 acetone ar 2500 ml 236 23/001/0638/00/0/0/0 agar powder 500gm 237 23/001/0639/00/0/0/0 alpha naphol 500gm 238 23/001/0640/00/0/0/0 aluminium nitrate lr 500gm 239 23/001/0641/00/0/0/0 aluminium oxide activated (neutral) lr 500gm 240 23/001/0642/00/0/0/0 aluminium potassium sulphate ar 500gm 241 23/001/0643/00/0/0/0 ammonia solution 25% ar 2500 ml 242 23/001/0644/00/0/0/0 ammonium acetate ar 500gm 243 23/001/0645/00/0/0/0 ammonium chloride lr 500gm 244 23/001/0646/00/0/0/0 ammonium ferric citrate lr 500gm 245 23/001/0647/00/0/0/0 ammonium ferrous sulphate lr 500gm 246 23/001/0648/00/0/0/0 ammonium hydroxide 25% lr 2500 ml 247 23/001/0649/00/0/0/0 ammonium molybdate lr 100gm 248 23/001/0650/00/0/0/0 ammonium oxalate lr 500gm 249 23/001/0651/00/0/0/0 ammonium perpurate ar 5gm 250 23/001/0652/00/0/0/0 ammonium purpurate ar 5gm 251 23/001/0653/00/0/0/0 annatto 1mg 252 23/001/0654/00/0/0/0 antimony 1000mg/i aas grade 100ml 253 23/001/0655/00/0/0/0 antimony trichloride ar 100gm 254 23/001/0656/00/0/0/0 arsenic trioxide lr 500gm 255 23/001/0657/00/0/0/0 ascorbic acid ar 100gm 256 23/001/0658/00/0/0/0 bacto peptone granular ar 500gm 257 23/001/0659/00/0/0/0 brillient green bile lactose broth 500gm 258 23/001/0660/00/0/0/0 bromocresol green indicator ar 5gm 259 23/001/0661/00/0/0/0 buffer solution (ph 4.0) nist 250ml 260 23/001/0662/00/0/0/0 buffer solution (ph 7.0) nist 250ml 261 23/001/0663/00/0/0/0 buffer solution (ph 9.0) nist 250ml 262 23/001/0664/00/0/0/0 buffered pepton water 500ml 263 23/001/0665/00/0/0/0 butanol lr 500ml 264 23/001/0666/00/0/0/0 cadmium gradules 40 60 mesh size ar 100gm 265 23/001/0667/00/0/0/0 calcium carbonate lr 500gm 266 23/001/0668/00/0/0/0 calcium chloride anhydrous lr 500gm 267 23/001/0669/00/0/0/0 calcium chloride dehydrated lr 500gm 268 23/001/0670/00/0/0/0 calcium hydroxide lr 500gm 269 23/001/0671/00/0/0/0 calcium nitrate lr 500gm 270 23/001/0672/00/0/0/0 calcium oxalate lr 500gm 271 23/001/0673/00/0/0/0 calcium oxide lr 500gm 272 23/001/0674/00/0/0/0 carbon disulphide lr 500ml 273 23/001/0675/00/0/0/0 carbon tetrachloride ar 2500ml 274 23/001/0676/00/0/0/0 carminic acid 98% ar ar 1gm 275 23/001/0677/00/0/0/0 chloride standard 1000mg/i aas grade 100ml 276 23/001/0678/00/0/0/0 chloroamphenicol glucose yeast extract agar 500gm 277 23/001/0679/00/0/0/0 cholesterol 1gm 278 23/001/0680/00/0/0/0 chromium trioxide lr 500gm 279 23/001/0681/00/0/0/0 chromogenic coliform agar 500gm 280 23/001/0682/00/0/0/0 chromotropic acid disodium ar 10gm 281 23/001/0683/00/0/0/0 citric acid ar 500gm 282 23/001/0684/00/0/0/0 cobalt sulphate lr 100gm 283 23/001/0685/00/0/0/0 cobaltous chloride (cocl36h20) ar 5gm 284 23/001/0686/00/0/0/0 conc. hydrochloric acid (sp.gr.1.19) ar 500ml 285 23/001/0687/00/0/0/0 copper acetate lr 500gm 286 23/001/0688/00/0/0/0 curcumin ar 5gm 287 23/001/0689/00/0/0/0 cyclohexane ar 2500 ml 288 23/001/0690/00/0/0/0 devardas alloy powder ar 100gm 289 23/001/0691/00/0/0/0 di chloro dimethyl silane (dds) ar 100gm 290 23/001/0692/00/0/0/0 di methyl glyoxine ar 100gm 291 23/001/0693/00/0/0/0 di phenyl amine ar 100gm 292 23/001/0694/00/0/0/0 di potassium hydrogen phosphate ar 500gm 293 23/001/0695/00/0/0/0 di sodium hydrogen phosphate ar 500gm 294 23/001/0696/00/0/0/0 di ammonium hydrogen phosphate ar 500gm 295 23/001/0697/00/0/0/0 dichloromethane ar 500ml 296 23/001/0698/00/0/0/0 diethyl ether lr lr 25lit 297 23/001/0699/00/0/0/0 diethylene glycol ar 500ml 298 23/001/0700/00/0/0/0 dioctyl sodium sulphosuccinate ar 500gm 299 23/001/0701/00/0/0/0 diphenylamine lr 100gm 300 23/001/0702/00/0/0/0 disodium ethylenediamine tetraacetic aciddihydrate ar 500gm 301 23/001/0703/00/0/0/0 di sodium tetraborate decahydrate ar 500gm 302 23/001/0704/00/0/0/0 erichrome black t indicator ar 25gm 303 23/001/0705/00/0/0/0 erychrome blue black r ar 25gm 304 23/001/0706/00/0/0/0 ethylene glycol monobutyl ether ar 1lit 305 23/001/0707/00/0/0/0 fehling a (copper sulphate) ar 500 ml 306 23/001/0708/00/0/0/0 fehling b (pottassium sodium tartrate) ar 500ml 307 23/001/0709/00/0/0/0 ferric chloride lr 500gm 308 23/001/0710/00/0/0/0 ferric nitrate ar 500gm 309 23/001/0711/00/0/0/0 ferrous sulphate heptahydrate lr 500gm 310 23/001/0712/00/0/0/0 fluoride standard 1000mg/i aas grade 100ml 311 23/001/0713/00/0/0/0 fromic acid lr 500ml 312 23/001/0714/00/0/0/0 glacial acetic acid ar 2500 ml 313 23/001/0715/00/0/0/0 glucose lr 500gm 314 23/001/0716/00/0/0/0 glycerol ar 2500 ml 315 23/001/0717/00/0/0/0 hydrochloric acid ar 2500 ml 316 23/001/0718/00/0/0/0 hydroxylamine hydrochloride lr 100gm 317 23/001/0719/00/0/0/0 iodine tri chloride ar 25gm 318 23/001/0720/00/0/0/0 iso amyl alcohol lr 2500 ml 319 23/001/0721/00/0/0/0 iso octane ar 500ml 320 23/001/0722/00/0/0/0 isopropyl alcohol 95% ar 2500 ml 321 23/001/0723/00/0/0/0 l ascorbic acid (c6h8o6) ar 100gm 322 23/001/0724/00/0/0/0 lactose broth 500gm 323 23/001/0725/00/0/0/0 lead acetate trihydrate lr 500gm 324 23/001/0726/00/0/0/0 magnasium chloride hexahydrate ar 500gm 325 23/001/0727/00/0/0/0 magnasium oxide lr 500gm 326 23/001/0728/00/0/0/0 magnasium sulphate lr 500gm 327 23/001/0729/00/0/0/0 mcconkey broth 500gm 328 23/001/0730/00/0/0/0 metaphosphoric acid lr 500gm 329 23/001/0731/00/0/0/0 methyl isobutyl ketone lr 500ml 330 23/001/0732/00/0/0/0 methyl orange lr 25gm 331 23/001/0733/00/0/0/0 methyl red lr 25gm 332 23/001/0734/00/0/0/0 n,n diethyl p phenylenediamine ar 100gm 333 23/001/0735/00/0/0/0 n 1 naphthyl ethylene diamine dihydrochloride ar 10gm 334 23/001/0736/00/0/0/0 nesslers reagent lr 250ml 335 23/001/0737/00/0/0/0 neutral red indicator powder ar 10gm 336 23/001/0738/00/0/0/0 n hexane ar 2500 ml 337 23/001/0739/00/0/0/0 nitric acid ar 2500 ml 338 23/001/0740/00/0/0/0 o phosphoric acid ar 500ml 339 23/001/0741/00/0/0/0 ortho toluidine ar 500ml 340 23/001/0742/00/0/0/0 p dimethyl amino benzaldehyde (pdab) ar 25gm 341 23/001/0743/00/0/0/0 para toluidine ar 500gm 342 23/001/0744/00/0/0/0 parafin oil (mineral oil) lr 500ml 343 23/001/0745/00/0/0/0 patton and reeders reagent ar 25gm 344 23/001/0746/00/0/0/0 pera di methylamino benzaldehyde ar 100gm 345 23/001/0747/00/0/0/0 perchloric acid (sp.gr.1.67) ar 500ml 346 23/001/0748/00/0/0/0 petrolium ether (40 60 c) lr 2500 ml 347 23/001/0749/00/0/0/0 petrolium ether (40 60 c) ar 2500 ml 348 23/001/0750/00/0/0/0 petrolium ether (60 80 c) ar 2500 ml 349 23/001/0751/00/0/0/0 phenol ar 100gm 350 23/001/0752/00/0/0/0 phosphomolybdic acid ar 25gm 351 23/001/0753/00/0/0/0 phosphoric acid (sp.gr.1.71g/ml) ar 1lit 352 23/001/0754/00/0/0/0 picric acid lr 500gm 353 23/001/0755/00/0/0/0 plaster of paris lr 500gm 354 23/001/0756/00/0/0/0 plate count agar ar 500gm 355 23/001/0757/00/0/0/0 potassium chloroplatinate (k2ptcl6) ar 1gm 356 23/001/0758/00/0/0/0 potassium dihydrogen orthophosphate anhydrous ar 500gm 357 23/001/0759/00/0/0/0 potassium nitrate ar 500gm 358 23/001/0760/00/0/0/0 potassium chromate ar 500gm 359 23/001/0761/00/0/0/0 potassium dichromate nist 45gm 360 23/001/0762/00/0/0/0 potassium dihydrogen phosphate ar 500gm 361 23/001/0763/00/0/0/0 potassium hexacynoferrate ar 500gm 362 23/001/0764/00/0/0/0 potassium hydrogen phosphate (k2hpo4) ar 500gm 363 23/001/0765/00/0/0/0 potassium hydrogen phthalate nist 45gm 364 23/001/0766/00/0/0/0 potassium hydroxide ar 500gm 365 23/001/0767/00/0/0/0 potassium sodium tartrate lr 500gm 366 23/001/0768/00/0/0/0 potassium sulphate lr 500gm 367 23/001/0769/00/0/0/0 potassium thiocyanate lr 500gm 368 23/001/0770/00/0/0/0 potassium di hydrogen phosphate ar 500gm 369 23/001/0771/00/0/0/0 pyridine ar 500ml 370 23/001/0772/00/0/0/0 quinoline ar 500ml 371 23/001/0773/00/0/0/0 resorcinol lr 100gm 372 23/001/0774/00/0/0/0 ringer salt solution powder 100gm 373 23/001/0775/00/0/0/0 rosalic acid lr 500gm 374 23/001/0776/00/0/0/0 sacchrin 98% ar 500gm 375 23/001/0777/00/0/0/0 silica gel 60 (0.063 0.2mm) lr 500gm 376 23/001/0778/00/0/0/0 silver suphate ar 25gm 377 23/001/0779/00/0/0/0 skimmed milk agar 500gm 378 23/001/0780/00/0/0/0 sodium acetate lr 500gm 379 23/001/0781/00/0/0/0 sodium acetate anhydrous lr 500gm 380 23/001/0782/00/0/0/0 sodium arsenite ar 100gm 381 23/001/0783/00/0/0/0 sodium benzoate lr 500gm 382 23/001/0784/00/0/0/0 sodium bicarbonate ar 500gm 383 23/001/0785/00/0/0/0 sodium bisulphite lr 500gm 384 23/001/0786/00/0/0/0 sodium borate lr 500ml 385 23/001/0787/00/0/0/0 sodium chloride lr 500gm 386 23/001/0788/00/0/0/0 sodium cyanide ar 500gm 387 23/001/0789/00/0/0/0 sodium deoxycholate ar 25gm 388 23/001/0790/00/0/0/0 sodium dihydrogen o phosphate lr 500gm 389 23/001/0791/00/0/0/0 sodium fluoride ar 500gm 390 23/001/0792/00/0/0/0 sodium hydrosulphite lr 500gm 391 23/001/0793/00/0/0/0 sodium hydroxide ar 500gm 392 23/001/0794/00/0/0/0 sodium hypochlorite lr 500ml 393 23/001/0795/00/0/0/0 sodium molybdate ar 100gm 394 23/001/0796/00/0/0/0 sodium nitrate ar 500gm 395 23/001/0797/00/0/0/0 sodium nitrite ar 500gm 396 23/001/0798/00/0/0/0 sodium oxalate ar 500gm 397 23/001/0799/00/0/0/0 sodium sulfite anhydrous ar 500gm 398 23/001/0800/00/0/0/0 sodium sulphate ar 500gm 399 23/001/0801/00/0/0/0 sodium thiosulphate pentahydrate ar 500gm 400 23/001/0802/00/0/0/0 soluble starch lr 500gm 401 23/001/0803/00/0/0/0 standard calcium solution 1000mg/l aas grade 100ml 402 23/001/0804/00/0/0/0 standard magnasium solution 1000mg/l aas grade 100ml 403 23/001/0805/00/0/0/0 stannous chloride ar 100gm 404 23/001/0806/00/0/0/0 succinic anhydride lr 100gm 405 23/001/0807/00/0/0/0 sulphanilamide ar 500gm 406 23/001/0808/00/0/0/0 sulphuric acid ar 2500 ml 407 23/001/0809/00/0/0/0 sulphuric acid (sp.gr.1.21gm/ml) ar 1lit 408 23/001/0810/00/0/0/0 tartaric acid lr 500gm 409 23/001/0811/00/0/0/0 thio barbituric acid (tba) ar 25gm 410 23/001/0812/00/0/0/0 thymol blue indicator ar 5gm 411 23/001/0813/00/0/0/0 tisab:total ionic strength buffer solu. for fluoride electrode ar 1lit 412 23/001/0814/00/0/0/0 tlc silica 60 aluminum plate (20x20) (250 micron layer) 25plate 413 23/001/0815/00/0/0/0 tlc silica gel 60 f 254 aluminum backed 20x20 cm (200 micron) 50plates 414 23/001/0816/00/0/0/0 tlc silica gel rp 18 f 254s 10x20cm 50plate 415 23/001/0817/00/0/0/0 toluene ar 2500 ml 416 23/001/0818/00/0/0/0 trans 1,2 diaminocyclohexane n,n,n,ntetracetic acidmonohydrate ar25gm 417 23/001/0819/00/0/0/0 tri fluro acetic acid (tfa) lr 100ml 418 23/001/0820/00/0/0/0 tri sodium citrate lr 500gm 419 23/001/0821/00/0/0/0 triethanolamine ar 500ml 420 23/001/0822/00/0/0/0 tryptone soya agar 500gm 421 23/001/0823/00/0/0/0 urea ar 500gm 422 23/001/0824/00/0/0/0 violet red bile lactose agar (brbl) 500gm 423 23/001/0825/00/0/0/0 xylene ar 500ml 424 23/001/0826/00/0/0/0 zinc acetate lr 500gm 425 23/001/0827/00/0/0/0 zinc chloride lr 500gm 426 23/001/0828/00/0/0/0 zinc oxide lr 500gm 427 23/001/0829/00/0/0/0 zinc sulphate lr 500gm 428 23/001/0830/00/0/0/0 zirconium oxychloride octahydrate 99% ar 100gm 429 23/001/0831/00/0/0/0 ß sitosterol 5gm 430 23/001/0832/00/0/0/0 anti c antisera 5ml vial 431 23/001/0833/00/0/0/0 anti c antisera 5 ml vial 432 23/001/0834/00/0/0/0 anti e antisera 5 ml vial 433 23/001/0835/00/0/0/0 anti e antisera 5 ml vial 434 23/001/0836/00/0/0/0 anti kell antisera 5 ml vial 435 23/001/0837/00/0/0/0 pooled cell a 10 ml vial 436 23/001/0838/00/0/0/0 pooled cell b 10 ml vial 437 23/001/0839/00/0/0/0 12) disc no(gn 1) 438 23/001/0840/00/0/0/0 gram ve special antibiotic(total no of antibiotic 08) disc no(gn 2) 439 23/001/0841/00/0/0/0 gram +ve common antibiotic(total no of antibiotic 12) disc no(gp 1) 440 23/001/0842/00/0/0/0 gram +ve special antibiotic(total no of antibiotic 08) disc no(gp 2) 441 23/001/0843/00/0/0/0 pseudomonas antibiotic disc(total no of antibiotic 08)disc no(pseudo) 442 23/001/0844/00/0/0/0 enterococci antibiotic disc(total no. of disc 08) disc no(entero) 443 23/002/0001/00/0/0/0 double deionized water nccls type i jar of 5 liter 444 23/002/0002/00/0/0/0 acetone liquid lr 2500ml 445 23/002/0003/00/0/0/0 chloroform 500ml 446 23/002/0005/00/0/0/0 paraffin wax (melting point 58 60) 447 23/002/0006/00/0/0/0 ammonium molybdate powder 500 gms. 448 23/002/0007/00/0/0/0 xylene sulfar free 2500ml 449 23/002/0008/00/0/0/0 barium chloride powder lr 500gm 450 23/002/0009/00/0/0/0 barium chloride solution 500ml 451 23/002/0010/00/0/0/0 edta powder dipottasium salt ( bsc certified ar) 500gm 452 23/002/0011/00/0/0/0 edta powder disodium salt 500 gms. 453 23/002/0012/00/0/0/0 concentrated hydrochloric acid analytical grade 500ml 454 23/002/0013/00/0/0/0 hydrogen peroxide 6% 500ml 455 23/002/0017/00/0/0/0 urea powder 500 gms. 456 23/002/0018/00/0/0/0 immersion oil for microscope ceder wood oil 500ml 457 23/002/0019/00/0/0/0 isopropanol sq 2500ml 458 23/002/0021/00/0/0/0 ammonium sulphate analytical grade 500gm 459 23/002/0022/00/0/0/0 benzaldehyde lr 500ml 460 23/002/0024/00/0/0/0 copper sulphate analytical grade 500gm 461 23/002/0029/00/0/0/0 di sodium hydrogen phosphate (anhydrous) 500gm 462 23/002/0031/00/0/0/0 silica gel powder lr 500 gms. 463 23/002/0032/00/0/0/0 naphthalene nitrate 1 kg 464 23/002/0033/00/0/0/0 borax 1kg. 465 23/002/0034/00/0/0/0 glycerol 5 liter jar 466 23/002/0038/00/0/0/0 hydrogen peroxide 30% w/v lr 500ml 467 23/002/0039/00/0/0/0 oil red o (fat stain) 500 ml 468 23/002/0043/00/0/0/0 lactose monohydrate analytical grade 500gm 469 23/002/0045/00/0/0/0 potassium alum powder (haematoxylin stain preparation) 500 gms. 470 23/002/0046/00/0/0/0 maltose monohydrate analytical grade 500gm 471 23/002/0047/00/0/0/0 magnesiumm sulphate analytical grade 500 gm 472 23/002/0050/00/0/0/0 potassium di hydrogen phosphate 500gm 473 23/002/0052/00/0/0/0 phenolphthalein powder 100 gms. 474 23/002/0053/00/0/0/0 potassium chloride ar 500 gm 475 23/002/0056/00/0/0/0 potassium metabisulphate 500gm 476 23/002/0059/00/0/0/0 3.8% sodium sulphet 1 lit. 477 23/002/0060/00/0/0/0 sodium chloride powder analytical grade 500gm for ihc/for cell wash 478 23/002/0061/00/0/0/0 sodium azide lr 100gm 479 23/002/0063/00/0/0/0 sodium hydroxide pellets analytical grade 500gm 480 23/002/0068/00/0/0/0 sodium thiosulphate anhydrous 500gm,use for prepare reticulin stain 481 23/002/0069/00/0/0/0 hematin powder (ptah stain) 5gms. 482 23/002/0070/00/0/0/0 sucrose analytical grade 500gm 483 23/002/0071/00/0/0/0 tris buffer 99% pure grade 500 gms. 484 23/002/0075/00/0/0/0 disposable micro tips for auto pipetes (1 20 ul) 485 23/002/0076/00/0/0/0 molecular water, molecular grade, nuclease free water 500ml 486 23/002/0077/00/0/0/0 rnase away tm, chemical for cleaning 250ml 487 23/002/0078/00/0/0/0 serum vial storage box,capacity of box is 96 nos. 2 ml vial 488 23/002/0085/00/0/0/0 wooden stick 489 23/002/0086/00/0/0/0 sterile plastic graduated 15ml centrifuge tube conical polypropylene 490 23/002/0087/00/0/0/0 imipenam/edta 10/750 mcg (single disc) for research work(botl 50 disc) 491 23/002/0088/00/0/0/0 cefoperazone/sulbactam 75/30 ug (single disc) for research, pack of 50 492 23/002/0089/00/0/0/0 gentamicin for hlar 120ug (single disc) 493 23/002/0090/00/0/0/0 hexa antimyco antifungal disc(6) (for antifungal sensitivity test 494 23/002/0091/00/0/0/0 doxycycline 30mcg disc, for routine lab. work (pack of 100disc) 495 23/002/0094/00/0/0/0 amber coloured glass dropping bottle 125ml 496 23/002/0096/00/0/0/0 voriconazole ( 1 ug) for antifungal sensitivity testing disc,pack of50 497 23/002/0098/00/0/0/0 aluminium foil 72 metre x 30cm, 11 micron thickness 498 23/002/0099/00/0/0/0 permanent marker pen (thin pointed) 499 23/002/0100/00/0/0/0 glass marking pencil 500 23/002/0102/00/0/0/0 bromocresol purple 501 23/002/0103/00/0/0/0 amphotericin b(50mcg) antifungal drugs 502 23/002/0104/00/0/0/0 clotrimazole (10mcg) antifungal drugs 503 23/002/0105/00/0/0/0 fluconazole (10mcg) antifungal drugs 504 23/002/0106/00/0/0/0 itraconazole (30mcg) antifungal drugs 505 23/002/0107/00/0/0/0 ketokonazole (30mcg) antifungal drugs 506 23/002/0108/00/0/0/0 miconazole (50mcg) antifungal drugs 507 23/002/0109/00/0/0/0 nystatin (100 units) antifungal drugs 508 23/002/0127/00/0/0/0 carbenicillin 100mcg (individual antibiotic disc) 509 23/002/0128/00/0/0/0 piperacillin 100mcg (individual antibiotic disc) 510 23/002/0129/00/0/0/0 ticarcillin 75mcg (individual antibiotic disc) 511 23/002/0130/00/0/0/0 ciprofloxacin 5mcg (individual antibiotic disc) 512 23/002/0131/00/0/0/0 cefepime 30mcg (individual antibiotic disc) 513 23/002/0132/00/0/0/0 cefoparazone 75mcg (individual antibiotic disc) 514 23/002/0133/00/0/0/0 ceftazidime 30 unit (individual antibiotic disc) 515 23/002/0134/00/0/0/0 ceftriaxon (30 mcg) antibiotic sensitivity disc 516 23/002/0135/00/0/0/0 novobiocin 5mcg (antibiotic sensitivity disc) 517 23/002/0136/00/0/0/0 atcc strain e. coli 25922 518 23/002/0137/00/0/0/0 atcc strain pseudomonas aeruginosa 27853 519 23/002/0138/00/0/0/0 atcc strain staph aureus 25923 520 23/002/0142/00/0/0/0 sabourds dextrose cycloheximide chlormphenicol agar 100gm 521 23/002/0143/00/0/0/0 mannitol salt agar 100gm 522 23/002/0144/00/0/0/0 glycine ar 100gm 523 23/002/0148/00/0/0/0 ammonium per sulfate aps 524 23/002/0151/00/0/0/0 bromocresol green 5gm 525 23/002/0152/00/0/0/0 standard amino acid set for chromatography 526 23/002/0153/00/0/0/0 ninhydrin powder ar 25 gm 527 23/002/0154/00/0/0/0 potassium iodide analytical grade (ar) 100gm 528 23/002/0157/00/0/0/0 chlorophenol red 5 gm 529 23/002/0158/00/0/0/0 creatinine ar 25 gm 530 23/002/0161/00/0/0/0 sodium tungstate ar 100gm 531 23/002/0164/00/0/0/0 dipotasium hydrogen phosphate powder 500gm 532 23/002/0165/00/0/0/0 sodium dihydrogen phosphate 500 gm 533 23/002/0166/00/0/0/0 celestain blue powder 500 gm 534 23/002/0167/00/0/0/0 methyl blue powder 500gm 535 23/002/0168/00/0/0/0 coombs serum igg 5ml vial 536 23/002/0169/00/0/0/0 blood group sera anti d monoclonal (igg) 10ml vial 537 23/002/0179/00/0/0/0 polymer kit for ihc dab,buffer and secondary antibody 538 23/002/0180/00/0/0/0 estrogen receptor for ihc 539 23/002/0181/00/0/0/0 progesterone receptor for ihc 540 23/002/0182/00/0/0/0 her 2 neu (c erbb2) for ihc 541 23/002/0183/00/0/0/0 pancytokeratin for ihc 542 23/002/0184/00/0/0/0 s 100 for ihc 543 23/002/0185/00/0/0/0 chromogranin for ihc 544 23/002/0186/00/0/0/0 cd 30 for ihc 545 23/002/0187/00/0/0/0 cea for ihc 546 23/002/0188/00/0/0/0 bel 2 for ihc 547 23/002/0189/00/0/0/0 cd 99 for ihc 548 23/002/0190/00/0/0/0 vimentin for ihc 549 23/002/0191/00/0/0/0 cd3 for ihc 550 23/002/0192/00/0/0/0 cd20 for ihc 551 23/002/0193/00/0/0/0 cd5 for ihc 552 23/002/0194/00/0/0/0 leucocyte common antigen (lca/cd45) for ihc 553 23/002/0195/00/0/0/0 smooth muscle actin (sma) for ihc 554 23/002/0196/00/0/0/0 hmb 45 for ihc 555 23/002/0197/00/0/0/0 cd117 for ihc 556 23/002/0198/00/0/0/0 desmin for ihc 557 23/002/0199/00/0/0/0 tris buffer powder for ihc 500 gm 558 23/002/0200/00/0/0/0 citric acid anhydrous for ihc 500 gms. 559 23/002/0201/00/0/0/0 poly l lysine for ihc 560 23/002/0202/00/0/0/0 atcc candida albicans control stain (for candida isolation) 561 23/002/0203/00/0/0/0 neuron specific enolase ihc marker (ready to use) 562 23/002/0204/00/0/0/0 calcitonin ihc marker (ready to use) 563 23/002/0205/00/0/0/0 prostate specific antigen ihc marker (ready to use) 564 23/002/0206/00/0/0/0 synaptophysin ihc marker (ready to use) 565 23/002/0207/00/0/0/0 non specific esterase ihc marker (ready to use) 566 23/002/0208/00/0/0/0 hep par 1 (ready to use) 567 23/002/0209/00/0/0/0 tdt (ready to use) 568 23/002/0210/00/0/0/0 ttf1 (ready to use) 569 23/002/0211/00/0/0/0 napsin (ready to use) 570 23/002/0212/00/0/0/0 p63 (ready to use) 571 23/002/0213/00/0/0/0 c kit (ready to use) 572 23/002/0215/00/0/0/0 ck20 (ready to use) 573 23/002/0216/00/0/0/0 cd34 (ready to use) 574 23/002/0217/00/0/0/0 ck5/6 (ready to use) 575 23/002/0218/00/0/0/0 ki 67 ag (mib 1) ready to use for ihc 576 23/002/0219/00/0/0/0 ema(epithalial membron ag)ready to use, for ihc in diagno. histopatho 577 23/002/0220/00/0/0/0 cd68 ready to use reagent, for ihc in diagno. histopathology 578 23/002/0221/00/0/0/0 cd31 ready to use reagent, for ihc in diagno. histopathology 579 23/002/0222/00/0/0/0 calretinin ready to use reagent,for ihc in diagno. histopathology 580 23/002/0223/00/0/0/0 cd15 ready to use reagent, for ihc in diagno. histopathology 581 23/002/0224/00/0/0/0 anginase 1ready to use reagent, for ihc in diagno. histopathology 582 23/002/0225/00/0/0/0 glipican 3 ready to use reagent,for ihc in diagno. histopathology 583 23/002/0226/00/0/0/0 ck 19 ready to use reagent,for ihc in diagno. histopathology 584 23/002/0227/00/0/0/0 moc31(eplam)ready to use reagent,for ihc in diagno. histopathology 585 23/002/0228/00/0/0/0 pax 2 or pax 8 ready to use reagent, for ihc in diagno. histopatho 586 23/002/0229/00/0/0/0 myogenin (ready to use) 587 23/002/0230/00/0/0/0 dog (ready to use) 588 23/002/0231/00/0/0/0 afp (ready to use) 589 23/002/0232/00/0/0/0 ca 19.9 (ready to use) 590 23/002/0233/00/0/0/0 calponin 1 (ready to use) 591 23/002/0234/00/0/0/0 kappa/lamda light chain (ready to use) 592 23/002/0235/00/0/0/0 muc 2 (ready to use) 593 23/002/0236/00/0/0/0 p 16 (ready to use) 594 23/003/0109/00/0/0/0 11 panel cell for antibody screening 595 23/003/0110/00/0/0/0 3 panel cell for antibody screening 596 23/004/0001/00/0/0/0 haemoglobin stirrer 597 23/004/0002/00/0/0/0 haemoglobin pipette 0.2% 598 23/004/0003/00/0/0/0 haemoglobin tube square (14.5 gm=100%) 599 23/004/0004/00/0/0/0 wintrobe tube 600 23/004/0005/00/0/0/0 tips box (50 200 ul tips) 601 23/004/0006/00/0/0/0 esrite pipettes 602 23/004/0007/00/0/0/0 cover slip for w.b.c.count box of 20 packets 603 23/004/0010/00/0/0/0 durhams tube 604 23/004/0011/00/0/0/0 sheep blood agar plate disposable 605 23/004/0012/00/0/0/0 measuring cylinder 250 ml plastic autoclavable 606 23/004/0013/00/0/0/0 measuring cylinder 500 ml plastic autoclavable 607 23/004/0014/00/0/0/0 measuring cylinder 1000 ml plastic autoclavable 608 23/004/0015/00/0/0/0 beaker with spout 50 ml borosilicate glass 609 23/004/0017/00/0/0/0 petri dish 100mm plastic autoclavable 610 23/004/0019/00/0/0/0 sterile plastic petri dish (disposable) (90mm) for routine lab. work 611 23/004/0020/00/0/0/0 cz.laboval microscop bulb 6v sw si 0 1 a,6vx20w helogen 612 23/004/0022/00/0/0/0 improved neubers chamber standard quality 613 23/004/0023/00/0/0/0 pasture pipette with rubber cork 614 23/004/0025/00/0/0/0 plain bulb with labled and rubber cap 10ml capacity 615 23/004/0026/00/0/0/0 pap pen used for marking on ihc slides 616 23/004/0027/00/0/0/0 glass trough with lid for staining slides 150 x 110 70 mm 617 23/004/0028/00/0/0/0 spreader slides packet of 10 nos. 618 23/004/0031/00/0/0/0 cover glasses 18mm square (thin no.1) box of 20 packets 619 23/004/0032/00/0/0/0 glass museum jar with lid(cover) big (30*20*10)cm3 620 23/004/0033/00/0/0/0 glass museum jar with lid(cover) big (25*15*10)cm3 621 23/004/0034/00/0/0/0 glass museum jar with lid square (20*20*10)cm3 622 23/004/0035/00/0/0/0 glass museum jar with lid square (20*20*15) cm3 623 23/004/0036/00/0/0/0 glass museum jar with lid square (20*15*10) cm3 624 23/004/0037/00/0/0/0 glass museum jar with lid small (15*10*5) cm3 625 23/004/0038/00/0/0/0 glass museum jar with lid very small (10*5*5)cm3 626 23/004/0040/00/0/0/0 cover glasses 22mm square (thin no.1) box of 20 packets 627 23/004/0041/00/0/0/0 cover glasses 22*50mm (thin no.1) box of 20 packets 628 23/004/0042/00/0/0/0 beaker with spout 100ml borosilicate glass 629 23/004/0044/00/0/0/0 beaker with spout 500ml borosilicate glass 630 23/004/0045/00/0/0/0 beaker with spout 1000ml borosilicate glass 631 23/004/0051/00/0/0/0 measuring cylinder 250ml borosilicate glass 632 23/004/0052/00/0/0/0 measuring cylinder 500ml borosilicate glass 633 23/004/0054/00/0/0/0 acrylic museum jar with lid small (15*15*10) cm 634 23/004/0055/00/0/0/0 acrylic museum jar with lid medium (20*15*10) cm 635 23/004/0056/00/0/0/0 blood culture glass bottle 636 23/004/0057/00/0/0/0 filter paper no.9 (90 mm) box of 100 nos. 637 23/004/0059/00/0/0/0 brain heart infusion broth 500gm 638 23/004/0062/00/0/0/0 cled agar 100gm 639 23/004/0065/00/0/0/0 cary blair medium 100gm 640 23/004/0067/00/0/0/0 x.l.d. agar 100gm 641 23/004/0069/00/0/0/0 selenite f broth 100gm 642 23/004/0070/00/0/0/0 amber coloured bottle 250 ml borosilicate glass 643 23/004/0078/00/0/0/0 blood culture bottle with bhi with 0.05 sps 70ml 644 23/004/0079/00/0/0/0 blood culture bottle with bhi with 0.05 sps 20ml 645 23/004/0080/00/0/0/0 beaker 1000ml (autoclavable plastic) 646 23/004/0081/00/0/0/0 beaker 500ml (autoclavable plastic) 647 23/004/0082/00/0/0/0 beaker 250ml (autoclavable plastic) 648 23/004/0083/00/0/0/0 dreyers tubes for widal test 649 23/004/0084/00/0/0/0 felix tubes for widal test 650 23/004/0085/00/0/0/0 aspiration bottle 1 lit. 651 23/004/0087/00/0/0/0 beaker borosilicate 2 ltr. 652 23/004/0088/00/0/0/0 glass stirrer 653 23/004/0089/00/0/0/0 measuring cylinder 25ml borosicate glass 654 23/004/0090/00/0/0/0 measuring cylinder 2 ltr. borosilicate glass 655 23/004/0091/00/0/0/0 reagent bottle borosilicate 500ml 656 23/004/0092/00/0/0/0 urine collection jar conical 657 23/004/0093/00/0/0/0 volumetric flask 100ml 658 23/004/0094/00/0/0/0 volumetric flask 500ml 659 23/004/0097/00/0/0/0 microscope helogen bulb 6v, 30w 660 23/004/0099/00/0/0/0 pipette 10ml graduated borosilicate glass 661 23/004/0100/00/0/0/0 standard measuring flask 100ml borosilicate 662 23/004/0103/00/0/0/0 measuring cylinder 50ml borosilicate 663 23/004/0104/00/0/0/0 precoated microscopic slides for ihc 664 23/004/0105/00/0/0/0 multichannel micropipette 100 1000ul variable (for washin elisa) 665 23/004/0107/00/0/0/0 antibiotic disc dispensor 8 position antibiotic single disc 666 23/004/0108/00/0/0/0 aluminium horizontal tray (strong,good quality,to hold 20 slide) 667 23/004/0109/00/0/0/0 sterile nylon flocked sweb/decron swab for collection of sample 668 23/004/0110/00/0/0/0 coated slides for cytocentrifuge with one circle over it(cytospin 4 669 23/004/0113/00/0/0/0 plastic jars for surgical specimen 100 ml 670 23/004/0114/00/0/0/0 plastic jars for surgical specimen 500 ml 671 23/004/0117/00/0/0/0 four clot coagulometer cuvette with stirrer close system 672 23/004/0118/00/0/0/0 chart paper 10c to +40c for penpole comp. 2c to 6c freeze 673 23/004/0119/00/0/0/0 chart paper +50c to 100c for penpole comp. 40c 80c freeze 674 23/004/0120/00/0/0/0 chart paper 10c to +40c for remi company 2c to freeze 675 23/004/0121/00/0/0/0 chart paper 10c to +40c for haier comp. 2c to 6c freeze 676 23/004/0124/00/0/0/0 sample cup large size for bio chemistry dept. 677 23/004/0125/00/0/0/0 sample cup small size for bio chemistry dept. 678 23/004/0126/00/0/0/0 eppendroff tube (alliquote) 2.5ml 679 23/004/0127/00/0/0/0 printer paper roll 57mm x 25 meter 680 23/004/0129/00/0/0/0 chart paper +50c to 100c,6 size,round for haier,deep freeze 40c& 80c 681 23/004/0137/00/0/0/0 thermograph marker pen, fibre tip pen, red, 06mm size 682 23/004/0138/00/0/0/0 aluminium cap for blood culture bottle sealing 20mm diameter 683 23/004/0139/00/0/0/0 glass beads 500gm 684 23/004/0140/00/0/0/0 grade 1 filter paper sheet 46x57cm (11μm at 98% efficiency) 100sheet 685 23/004/0141/00/0/0/0 ph paper strip (0 to 14.0) 100 strip 686 23/004/0142/00/0/0/0 ph paper strip (6.5 to 10.0) 100 strip 687 23/004/0143/00/0/0/0 dishes,evaporating,flat bottom,with pour out 165ml class b certified 688 23/004/0144/00/0/0/0 r m value apparatus 300ml class b certified 689 23/004/0145/00/0/0/0 flasks,erlenmeyer,conical,narow mouth with interchange stopers 100ml 690 23/004/0146/00/0/0/0 flasks,erlenmeyer,conical,narow mouth with interchange stopers 250ml 691 23/004/0147/00/0/0/0 flasks,erlenmeyer,conical,narow mouth with interchange stopers 500ml 692 23/004/0148/00/0/0/0 flasks,iodine determination, with interchangable stoper 250ml 693 23/004/0149/00/0/0/0 funnels,separating pear shape,fitted with boroflo stopcock with ptfe 694 23/004/0150/00/0/0/0 funnels,separating pear shape,fitted with boroflo stopcock with ptfe 695 23/004/0151/00/0/0/0 pipette volumetric treansfer class b 30ml class certified 696 23/004/0152/00/0/0/0 flasks,tilt measure 10ml class b certified 697 23/004/0153/00/0/0/0 gerber milk pipette 10.75ml class b certified 698 23/004/0154/00/0/0/0 crusible gooch type low form with sintered disks,porosity 2 50ml 699 23/004/0155/00/0/0/0 tubes,filter,for gooch crusibles (herarchi) funnel 36*160mm 700 23/004/0156/00/0/0/0 buckner funnel with sintered glass,porosity 2 35ml class b certified 701 23/004/0157/00/0/0/0 flask volumetric,sugar estimatipon without stoper comply with bs 675 702 23/004/0158/00/0/0/0 condensers,allihn,drip tip,interchangeable inner and outer joint 19/26 703 23/004/0159/00/0/0/0 condensers,allihn,drip tip,interchangeable inner and outer joint 24/29 704 23/004/0160/00/0/0/0 silicone tubing for distillation unit& lab.application 6mmx9mm(10mter) 705 23/004/0161/00/0/0/0 distilling apparatus,compact with friedrichs 1000ml class b certified 706 23/004/0162/00/0/0/0 condenser, interchangeable joint 25mm class b certified 707 23/004/0163/00/0/0/0 funnels,plain,600 angle, short stem 50mm class certified 708 23/004/0164/00/0/0/0 crucibles, without lid 50ml class b certified 709 23/004/0165/00/0/0/0 double burette clamp aluminium pdc class b certified 710 23/004/0166/00/0/0/0 pointer spatula 6 inch class b certified 711 23/004/0167/00/0/0/0 flasks,boiling,flat bottom,short neck,interchangeable joint 150ml 712 23/004/0168/00/0/0/0 flasks,boiling,flat bottom,short neck,interchangeable joint 250ml 713 23/004/0169/00/0/0/0 flasks,boiling,flat bottom,short neck,interchangeable joint 500ml 714 23/004/0170/00/0/0/0 burrette 10ml class a certified 715 23/004/0171/00/0/0/0 burrette 25ml class a certified 716 23/004/0172/00/0/0/0 burrette 50ml class a certified 717 23/004/0173/00/0/0/0 measuring cylinder 25 ml class a certified 718 23/004/0174/00/0/0/0 measuring cylinder 50 ml class a certified 719 23/004/0175/00/0/0/0 measuring cylinder 100 ml class a certified 720 23/004/0176/00/0/0/0 measuring pipette 1ml (0.1 graduation) class a certified 721 23/004/0177/00/0/0/0 measuring pipette 2ml (0.1 graduation) class a certified 722 23/004/0178/00/0/0/0 measuring pipette 5ml (0.1 graduation) class a certified 723 23/004/0179/00/0/0/0 measuring pipette 10ml class a certified 724 23/004/0180/00/0/0/0 measuring pipette 25ml class a certified 725 23/004/0181/00/0/0/0 measuring pipette 0.1ml class a certified 726 23/004/0182/00/0/0/0 volumetric pipette 10ml class a certified 727 23/004/0183/00/0/0/0 volumetric pipette 25ml class a certified 728 23/004/0184/00/0/0/0 volumetric flask with glass stopperd 10ml class certified 729 23/004/0185/00/0/0/0 volumetric flask with glass stopperd 20ml class certified 730 23/004/0186/00/0/0/0 volumetric flask with glass stopperd 25ml class certified 731 23/004/0187/00/0/0/0 volumetric flask with glass stopperd 50ml class certified 732 23/004/0188/00/0/0/0 volumetric flask with glass stopperd 100ml class certified 733 23/004/0189/00/0/0/0 volumetric flask with glass stopperd 250ml class certified 734 23/004/0190/00/0/0/0 volumetric flask with glass stopperd 500ml class certified 735 23/004/0191/00/0/0/0 volumetric flask with glass stopperd 1000ml class a certified 736 23/004/0192/00/0/0/0 eppendrof tube 1.5ml molecular grade,dnase rnase free w/o filter tips 737 23/004/0193/00/0/0/0 eppendorf tube 1.5ml non binding polypropelene tube, molecular grade 738 23/004/0194/00/0/0/0 200ul tips w/o filter molecular grade,dnase rnase free w/o filter tips 739 23/004/0195/00/0/0/0 300ul tips w/o filter molecular grade,dnase rnase free w/o filter tips 740 23/004/0196/00/0/0/0 1000ul tips w/o filter molecular grade,dnase rnase free w/o filter tip 741 23/004/0197/00/0/0/0 filter tips 10ul filter barrier tips,molecular grade,dnase rnase free 742 23/004/0198/00/0/0/0 filter tips 20ul,filter barrier tips,molecular grade,dnase rnase free 743 23/004/0199/00/0/0/0 filter tips 200ul,filter barrier tips,molecular grade,dnase rnase free 744 23/004/0200/00/0/0/0 filter tips 1000ul filter barrier tip,molecular grade,dnase rnase free 745 23/004/0201/00/0/0/0 falcon tube/urine centrifuge,tube l: above13cm,dia.3cm,capa. 60ml 746 23/004/0203/00/0/0/0 pcr cooler 96 well plate pcr holding,gel field( 20deg) color changing 747 23/005/0001/00/0/0/0 esrite sample filling plastic vials 748 23/005/0009/00/0/0/0 disposable tips small (0 200ul) packet of 1000 nos. 749 23/005/0011/00/0/0/0 melting point capillary ( packet of 100 numbers) 750 23/005/0012/00/0/0/0 turnicate tube 751 23/005/0018/00/0/0/0 lancet needle,disposables,sterile,s.s.material 752 23/005/0025/00/0/0/0 nichrome loop with handle 24 gauze changeble nichrome loop 753 23/005/0026/00/0/0/0 nichrome wire with handle 24 gauze changeble nichrome wire 754 23/005/0027/00/0/0/0 nichrome wire 24 gauze 755 23/005/0028/00/0/0/0 nichrome loop 24 gauze 756 23/005/0030/00/0/0/0 hb. meter (hb estimation)prismatic square tube with accessories 757 23/005/0031/00/0/0/0 sterilized plas.container for urine & sputum wide mouth cap. 100ml 758 23/005/0035/00/0/0/0 plastic dropper for sample taking 759 23/005/0036/00/0/0/0 polytube (ria vial)12x75mm (polyurethane tube non stick material) 760 23/005/0041/00/0/0/0 urine collection flask plastic (10ml capacity) 761 23/005/0042/00/0/0/0 coplin jar(plas.)with cover stain purpose 30ml capacity 762 23/005/0043/00/0/0/0 rubber bulb small 763 23/005/0044/00/0/0/0 couplin jar 100 ml borosilicate glass 764 23/005/0045/00/0/0/0 turnicate belt 765 23/005/0050/00/0/0/0 microscope objectives imported, high power lence 45x 766 23/005/0053/00/0/0/0 band aid spot 22mm diameter 767 23/005/0058/00/0/0/0 disposable tips large (100 1000 ul) packet of 1000 nos. 768 23/005/0060/00/0/0/0 slide box plastic 50 slide capacity 769 23/005/0071/00/0/0/0 capilarys for absoluter micropietts 0.5 to 2 ul 770 23/005/0076/00/0/0/0 polyethylene wash bottel 1000ml 771 23/005/0077/00/0/0/0 polyethylene wash bottle 500 ml 772 23/005/0081/00/0/0/0 rubber bulb large 773 23/005/0082/00/0/0/0 microscope objectives imported oil immersion lence 100x 774 23/005/0083/00/0/0/0 new methylene blue 25 gm 775 23/005/0084/00/0/0/0 conc. nitric acid 500ml 776 23/005/0120/00/0/0/0 tissue cutting knives 777 23/005/0128/00/0/0/0 tissue cassets (plastic) 778 23/005/0165/00/0/0/0 ponceus s red powder 500gm 779 23/005/0166/00/0/0/0 destainer and cleaning solution 500ml 780 23/006/0004/00/0/0/0 mueller hinton agar 500gm 781 23/006/0006/00/0/0/0 sabourauds dextrose agar 100gm 782 23/006/0007/00/0/0/0 simmons citrate agar 100gm 783 23/006/0008/00/0/0/0 agar agar powder(purify for cult.media & bacterio.work) 500 gm 784 23/006/0009/00/0/0/0 alluminium perforated basket (4 x 4) 785 23/006/0010/00/0/0/0 aluminium test tube rack ( 8 x 4 holes) (60mm 786 23/006/0012/00/0/0/0 mycological needles 787 23/006/0015/00/0/0/0 test tube holder 788 23/006/0016/00/0/0/0 litmus paper 789 23/006/0018/00/0/0/0 anaerobic indicator tablet 790 23/006/0029/00/0/0/0 alpha nephthol 791 23/006/0034/00/0/0/0 corn meal agar 500 gm 792 23/006/0048/00/0/0/0 bile salt agar 793 23/006/0049/00/0/0/0 bromophenol blue powder 100gm 794 23/006/0050/00/0/0/0 dipotassium hypophosphate k2hpo4 500gm 795 23/006/0051/00/0/0/0 disodium hypophosphate na2hpo4 500gm 796 23/006/0052/00/0/0/0 sodium carbonate anhydrous lr 500gm 797 23/006/0055/00/0/0/0 measuring cylinder 1000ml borosilicate glass 798 23/006/0056/00/0/0/0 pipette 1ml graduated borosilicate glass 799 23/006/0057/00/0/0/0 pipette 2ml graduated borosilicate glass 800 23/006/0058/00/0/0/0 pipette 5ml graduated borosilicate glass 801 23/006/0061/00/0/0/0 widal test tube rack plastic 802 23/006/0063/00/0/0/0 amonium sulphate 500gm 803 23/006/0064/00/0/0/0 benzene ar 2500ml solution 804 23/006/0065/00/0/0/0 buffer tablet std. (ph 4.0) packet of 10 805 23/006/0066/00/0/0/0 buffer tablet std. (ph 7.0) packet of 10 806 23/006/0067/00/0/0/0 buffer tablet std. (ph 9.2) packet of 10 807 23/006/0069/00/0/0/0 egg albumin flakes analytical grade 500gm 808 23/006/0070/00/0/0/0 ferric chloride 20% solution 500ml 809 23/006/0071/00/0/0/0 jack bean meal 100gm 810 23/006/0073/00/0/0/0 n butanol 500ml 811 23/006/0074/00/0/0/0 potassium ferrocyanide ar 500 gm 812 23/006/0076/00/0/0/0 sudan iii powder stain 25 gm 813 23/006/0077/00/0/0/0 sulphar powder lr 500gm 814 23/006/0081/00/0/0/0 acid fuschin 500gm 815 23/006/0082/00/0/0/0 alcian blue 8gx 500ml 816 23/006/0085/00/0/0/0 congo red 100gm 817 23/006/0086/00/0/0/0 ferric amonium sulphate ar 500gm 818 23/006/0087/00/0/0/0 gold chloride 1 gm 819 23/006/0089/00/0/0/0 oxalic acid powder ar 500 gm 820 23/006/0090/00/0/0/0 phosphomolybdic acid a.r (analytical grade) 500gm 821 23/006/0091/00/0/0/0 phospho tuvgstic acid analytical grade 100 gm 822 23/006/0095/00/0/0/0 pottasium nitrate 500 gm 823 23/006/0096/00/0/0/0 pottasium acetate 500 gm 824 23/006/0099/00/0/0/0 butter paper 825 23/006/0101/00/0/0/0 measuring cylinder 100ml borosilicate glass 826 23/006/0102/00/0/0/0 micropipette 1 to 40ul 827 23/006/0103/00/0/0/0 micropipette 20 to 200ul 828 23/006/0104/00/0/0/0 micropipette 200ul to 1ml 829 23/006/0105/00/0/0/0 pipette stand vertical plastic 830 23/006/0106/00/0/0/0 test tube glass 12 mm x 75 mm 831 23/006/0107/00/0/0/0 westernagreen pipette 832 23/006/0109/00/0/0/0 scalpel handle no.4 (s.s.) 833 23/006/0115/00/0/0/0 deodorizing pearls 834 23/006/0116/00/0/0/0 shigella antisera shigella boydii polyvalent 835 23/006/0118/00/0/0/0 shigella antisera shigella sonnei 836 23/006/0119/00/0/0/0 shigella antisera shigella flexneri polyvalent 837 25/001/0007/00/0/0/0 glass slide precleaned with polish edge (75x25x1.35)mm pkt of 50no 838 25/001/0022/00/0/0/0 reagent bottle 125 ml 839 25/001/0034/00/0/0/0 test tube 25*150mm class b certified 840 25/001/0036/00/0/0/0 test tube glass 125 mm x 15 mm 841 25/001/0037/00/0/0/0 test tube glass 150 mm x 18 mm 842 25/001/0038/00/0/0/0 test tube glass 75 mm x 10 mm borosilicate 843 25/001/0040/00/0/0/0 mc cartneys bottle 844 25/001/0045/00/0/0/0 petri dish 100 mm glass autoclavable 845 25/002/0003/00/0/0/0 diamond marker 846 25/002/0013/00/0/0/0 alluminium wire basket large size 12x9x7 847 25/002/0014/00/0/0/0 aluminium wire basket 9x8x6 848 25/002/0018/00/0/0/0 discarding bowls enamel 1000ml 849 25/002/0019/00/0/0/0 discarding bowls enamel 500ml 850 25/002/0024/00/0/0/0 esrite stand 10 tube with scale(to hold 5 pipete)access 851 25/002/0025/00/0/0/0 funnel 4 diameter borosilicate glass 852 25/002/0033/00/0/0/0 metal spatula for chemical media 853 25/002/0034/00/0/0/0 micropipettes 10ul fix. vol.(with stand table top calibration certi) 854 25/002/0035/00/0/0/0 micripipettes 20ul fix.vol.(with stand table top & calibration certi) 855 25/002/0036/00/0/0/0 micropipettes 25ul fix.vol.(with stand table top & calibration certi) 856 25/002/0037/00/0/0/0 micropipettes 50ul 200ul vari. volume with calibration certi 857 25/002/0038/00/0/0/0 micropipette 50ul fixed volume with calibration certi 858 25/002/0039/00/0/0/0 micropipette 5 ul fixed volume with calibration certi. 859 25/002/0040/00/0/0/0 micropipettes 1000ul fixed volume with calibration certi 860 25/002/0041/00/0/0/0 micropipette 200ul fixed volume with calibration certi. 861 25/002/0042/00/0/0/0 micropipette 500ul fixed volume with calibration certi. 862 25/002/0043/00/0/0/0 micropipette 5000ul fixed volume with calibration certi. 863 25/002/0044/00/0/0/0 micropipette 100ul 1000ul variable volume with calibration certi 864 25/002/0047/00/0/0/0 micropipette 2ul 20ul variable volume with calibration certi 865 25/002/0048/00/0/0/0 micropipette 5ul 50ul variable volume with calibration certi 866 25/002/0049/00/0/0/0 micropipette 0.5ul 10ul variable volume with calibration certi 867 25/002/0050/00/0/0/0 micropipette 10ul 100ul variable volume with calibration certi 868 25/002/0052/00/0/0/0 mould for holding tissue block big&ss with deep cavity 869 25/002/0053/00/0/0/0 mould for hold tissue block small,ss with deep cavity 870 25/002/0056/00/0/0/0 plastic dropping bottle (100ml) 871 25/002/0070/00/0/0/0 slide stand for drying (aluminium) it hold 20 slide 872 25/002/0077/00/0/0/0 test tube brush small 873 25/002/0078/00/0/0/0 test tube brush large 874 25/002/0079/00/0/0/0 test tube brush medium 875 25/002/0081/00/0/0/0 test tube stand 24 holes plastic for 12x100mm t. 876 25/002/0092/00/0/0/0 slide staining rack aluminium 24 inch of 2 rodes 877 25/003/0002/00/0/0/0 standard tube holder for vacutainer 878 25/003/0004/00/0/0/0 filter paper no. 1 ( 90 mm ) box of 100 nos. 879 25/003/0011/00/0/0/0 sv 5 vials (5ml) wide 5ml 880 25/003/0012/00/0/0/0 sv 2 vials (2ml) 881 25/003/0013/00/0/0/0 serum storage vial 0.5ml capacity 882 25/004/0001/00/0/0/0 absorbent paper points no.15 40, milimeter marked,colour coded 883 25/004/0002/00/0/0/0 absorbent paper points no. 45 80,milimeter marked,colour coded 884 25/004/0003/00/0/0/0 airotor diamond burs 885 25/004/0004/00/0/0/0 airotor handpiece oil spray cleaning & lubrication oil, bottle 500ml 886 25/004/0005/00/0/0/0 alginate impression mat.dust free, for dental use,pkt of 450gm 887 25/004/0006/00/0/0/0 alveogyl fibres (use for b of dry soket) paste for dental use,pkt 12gm 888 25/004/0007/00/0/0/0 articulating paper 889 25/004/0009/00/0/0/0 base plate packet of 12 nos 890 25/004/0010/00/0/0/0 bonding mat. 7th generation for self etch,adhesive, 5ml liquid 891 25/004/0011/00/0/0/0 calcium hydroxide paste (pulp caping) 1pkt 13gm base, 11gm catalyst 892 25/004/0013/00/0/0/0 calcium hydroxide with iodoform 1pkt with 2 syringe of 22gm each 893 25/004/0016/00/0/0/0 clove oil bottle of 110ml, for dental use 894 25/004/0018/00/0/0/0 cold cure acrylic for partial denture (pow/liq)pink,self polymerising 895 25/004/0020/00/0/0/0 dentim conditioner 896 25/004/0021/00/0/0/0 denture polishing buff medium size & small size,2no of each size 897 25/004/0022/00/0/0/0 denture soft liner, permanent 898 25/004/0028/00/0/0/0 erich arch bar (stainless steel) 899 25/004/0029/00/0/0/0 formocresol for dental use 20 ml 900 25/004/0030/00/0/0/0 gi sealant varnish,cavity varnish, protective coating,bottle 30ml 901 25/004/0032/00/0/0/0 glass ionomer cement luting & lining cement 902 25/004/0033/00/0/0/0 glass ionomer cement universal,restorative (type 2) 903 25/004/0035/00/0/0/0 green stick compound/ green tracing sticks packet of 10 nos. 904 25/004/0040/00/0/0/0 heat cure acrylic (pow/liq) pink, for dental use only 905 25/004/0041/00/0/0/0 impression compound pkts of 5 nos. 906 25/004/0044/00/0/0/0 lab stainless steel burkit 907 25/004/0045/00/0/0/0 lab tungsten carbidie burkit,white no 4.5.8.10 no 701.702.703,dental 908 25/004/0047/00/0/0/0 low modulus microhybrid flowable composite 909 25/004/0048/00/0/0/0 mandibular reconstruction plate,titanium,stainless steel 910 25/004/0051/00/0/0/0 modelling wax pink colour 1 pkt of 225gm 911 25/004/0058/00/0/0/0 plaster of paris for dental use 1 bag of 5kg 912 25/004/0060/00/0/0/0 polishing kit for composits 913 25/004/0061/00/0/0/0 pumice powder, for denture polishing 914 25/004/0062/00/0/0/0 restorative composite for ant.post.restoration, syringe of 5gm 915 25/004/0068/00/0/0/0 root canal instrument k file no 6 length 21mm (pkt of 6 no) 916 25/004/0069/00/0/0/0 root canal instrument k file no 8 length 21mm (pkt of 6 no) 917 25/004/0070/00/0/0/0 root canal instrument k file no 10 length 21mm (pkt of 6 no) 918 25/004/0077/00/0/0/0 root canal instrument spreader no.15 40 length 21mm (pkt of 6 no) 919 25/004/0078/00/0/0/0 root canal instrument spreader no.45 80 length 25mm (pkt of 6 no) 920 25/004/0085/00/0/0/0 rubber base impression (condentation silicon) 921 25/004/0090/00/0/0/0 seperating material jar of 3500ml, cold mould seal 922 25/004/0092/00/0/0/0 sodium hypochloride 5% for dental use only 500ml 923 25/004/0111/00/0/0/0 stainless steel wire (26 guage) 924 25/004/0112/00/0/0/0 stainless steel wire (28 guage) 925 25/004/0113/00/0/0/0 dental stone type 3, for dental use only, 1 bag of 3kg 926 25/004/0114/00/0/0/0 teeth set (complete)ref size acryrock no13(ant)no34(post)shade a2,b2 927 25/004/0117/00/0/0/0 yellow sticky wax for dental use pkt of 10 nos 928 25/004/0118/00/0/0/0 zinc oxide powder arcenic free, for dental use,bottle of 110gm 929 25/004/0121/00/0/0/0 zinc oxide eugenol impression paste for dental 930 25/004/0125/00/0/0/0 devitalyzing material paste(dental)for devitalization,syringe of 3gm 931 25/004/0129/00/0/0/0 suction tips (disosable) plastic packet of 100 nos. 932 25/004/0132/00/0/0/0 edta syringe, edta paste for dental use only, each syringe of 3gm 933 25/004/0133/00/0/0/0 acrylic trimmer for denture trimming 934 25/004/0134/00/0/0/0 mirror tops no.4 (for dental use) jenim 935 25/004/0137/00/0/0/0 atpanine stone 936 25/004/0140/00/0/0/0 sand paper mandril 937 25/004/0141/00/0/0/0 orthodontic wire 21g,19g,22g 938 25/004/0144/00/0/0/0 cynoacryralic paste of feviquick 939 25/004/0145/00/0/0/0 glass slab 940 25/004/0146/00/0/0/0 dappen dish 941 25/004/0154/00/0/0/0 teeth set (partial) denture include 6 ant.lower & 6 ant. upper 942 25/004/0155/00/0/0/0 teeth set (partial) denture include,8 upper & 8 lower 943 25/004/0157/00/0/0/0 photo cheek retractor ( plastic ) 944 25/004/0158/00/0/0/0 mouth prop ( rubber ) 945 25/004/0159/00/0/0/0 face guard ( plastic ) (each set contains 01 frame 05 shield) 946 25/004/0161/00/0/0/0 root canal instrument of k files 21mm length no. 947 25/004/0162/00/0/0/0 root canal instrument of k files 21mm length no.10 948 25/004/0164/00/0/0/0 dental mirror handle for no.4 mirror 949 25/004/0170/00/0/0/0 carver (lacrons ) for wax carving 950 25/004/0171/00/0/0/0 wax knife (one end rounded solid curve other end cutting knife) 951 25/004/0172/00/0/0/0 rubber bowl (big) soft rubber 952 25/004/0173/00/0/0/0 gutta purcha cone 2%(no.20)pkt 120 cone,milimeter marked,color coded 953 25/004/0174/00/0/0/0 gutta purcha cone 2%(no.25)pkt 120 cone,milimeter marked,color code 954 25/004/0175/00/0/0/0 gutta purcha cone 2%(no.30)pkt 120 cone,milimeter marked,color coded 955 25/004/0176/00/0/0/0 carbide bur (hp 702) for dental use 956 25/004/0177/00/0/0/0 k file 21mm length no: 15 957 25/004/0178/00/0/0/0 stainless steel wire no 19 to apply clasp in partial denture pt 958 25/004/0179/00/0/0/0 stainless steel wire no 20 to apply clasp in partial denture pt 959 25/004/0180/00/0/0/0 plaster spatula for mixing plaster, wooden handle 960 25/004/0181/00/0/0/0 titanium plate 2mm 4 hole with gape 961 25/004/0182/00/0/0/0 titanium plate 2mm 2 hole with gape 962 25/004/0184/00/0/0/0 root canal instrument k file no 15,length 21mm (pkt of 6 nos.) 963 25/004/0185/00/0/0/0 carbide bur (hp 703) for dental use only 964 25/004/0187/00/0/0/0 gutta purcha cones 2%(no 15)mm marked,color coded(pkt of 120cones) 965 25/004/0188/00/0/0/0 root canal instument k file no 20, length 21 mm 966 25/004/0189/00/0/0/0 root canal instument k file no 30, length 21 mm 967 25/004/0190/00/0/0/0 root canal instument k file no 35, length 21 mm 968 25/004/0191/00/0/0/0 root canal instument k file no 40, length 21 mm,(pkt of 6 nos) 969 25/004/0192/00/0/0/0 root canal instument h file no 10, length 21 mm 970 25/004/0193/00/0/0/0 root canal instument h file no 15, length 21 mm 971 25/004/0194/00/0/0/0 root canal instument h file no 20, length 21 mm 972 25/004/0195/00/0/0/0 root canal instument h file no 25, length 21 mm 973 25/004/0196/00/0/0/0 root canal instument h file no 30, length 21 mm 974 25/004/0197/00/0/0/0 root canal instument h file no 35, length 21 mm 975 25/004/0198/00/0/0/0 root canal instument h file no 40, length 21 mm 976 25/004/0199/00/0/0/0 root canal instument k file no 15, length 25 mm 977 25/004/0200/00/0/0/0 root canal instument k file no 20, length 25 mm 978 25/004/0201/00/0/0/0 root canal instument k file no 25, length 25 mm 979 25/004/0202/00/0/0/0 root canal instument k file no 30, length 25 mm 980 25/004/0203/00/0/0/0 root canal instument k file no 35, length 25 mm 981 25/004/0204/00/0/0/0 root canal instument k file no 40, length 25 mm 982 25/004/0205/00/0/0/0 root canal instument h file no 15, length 25 mm 983 25/004/0206/00/0/0/0 root canal instument k file no 45 80, length 25 mm 984 25/004/0207/00/0/0/0 gutta purcha cones 2% (no 35) millimeter marked,color coded 985 25/004/0208/00/0/0/0 gutta purcha cones 2% (no 40) millimeter marked,color coded,pkt of 120 986 25/004/0209/00/0/0/0 gutta purcha cones 2% (no 45 80) mm marked,color coded(pkt 120 nos) 987 25/004/0211/00/0/0/0 root canal instrument k file no 25, length 21mm (pkt of 6 nos.)...

Gujarat Medical Services Corporation Limited - Gujarat

23219666 supply of item : patholgy diagnostic kits & reagents 1. brilliant cresyl blue 2. potassium dihydrogen phosphate 3. drabkins solution for hb estimation with standard solution 4. deionised water 5. eosin y water soluble 6. giemsa powder 7. glycerol 8. methanol 9. tri sodium citrate liquid 3.2% 10. saponin 11. leishman stain powder 12. sodium dithionite 13. xylene(sulphur free) 14. papanicolaou stain kit ready to use, 15. dpx 16. carbol fuschin(powder) 17. formalin(40% formaldehyde in water) 18. hydrochloric acid(36%) 19. hematoxyline(powder) 20. peraffin wax for histopathology use with ceresin(melting point 58 60°c) 21. lia d dimer 22. aluminium potasium sulfate (alum) 23. nitric acid 24. isopropyl alcohol 25. ck prest 26. neoplastin 27. calcium chloride 28. dsorbe u 29. unicalibrator 30. cleaner solution 31. stago cuvettee roll 32. lia d dimer control (system control) 33. stirrer red 34. stirrer white 35. sodium metabisulphite 36. filter paper whatman grade no. 1 or equivalent 46 x 57 cm 37. dipotassium hydrogen phosphate(k2hpo4) 38. kit for esr (disposable tube with plug) 39. reagent kit for aptt 40. reagent kit for prothombin time 41. ependroff cup for stago coagulometer 42. urine strip 3 parameter (albu,glu,ph) 43. hematoxylin solution ready to use certified for microscopy 44. fibroprest 45. owren color buffer 46. factor deficiency viii 47. factor deficiency ix 48. coolant 49. uri strip for atleast 10parameters (urine albumin, ph, specific gravity, ketone, urobilinogen, rbc, glucose) leukocyte,bilirubin nitrite; ascorbate 50. l a reagent 51. control for fibrinogen 52. control for factor viii 53. control for factor ix 54. control for d dimer 55. reagent for la test 56. (harris) haematoxylin (ready to use) 57. leishmen stain (ready to use) with buffers 58. eosin (ready to use) 2% solution 59. reticulin stain (ready to use) 60. ziehl neelsen (ready to use) 61. edta dipotassium 62. hydrogen peroxide 30% 63. sulfur powder 64. lugols iodine 65. methyl violet solution 66. sodium hydroxide pellets 67. fdp 68. diffiecient factor v 69. diffiecient factor vii 70. diffiecient factor x 71. immersion oil for microscopy 72. acetone 73. 5 sulphosalicylic acid powder 74. trichloro acetic acid liquid 10% 75. liqor ammonia 76. glacial acetic acid aldihide free 77. copper sulphate (anhydrous) 78. fouchet reagent 79. barium chloride powder 80. benedicts reagent (qualitative) 81. sodium nitroprusside 82. urine container/sputum 83. capillary tube 84. fdp calibrator 85. slide tray (aluminum) 30x30 cms 86. tissue capsule metal 87. tissue capsule plastic 88. kit for stool occult blood with benzidine powder & hydrogen per oxide 89. microtips (20 300 microliter) 90. microtips 1000 microliter 91. microtips 5000 microliter 92. microtips 100 5000 microliter ,yellow color 93. plastic slide boxes of capacity 94. bromocresol blue 95. rbc diluting fluid 96. wbc diluting fluid 97. platelet diluting fluid 98. test tubes rack 99. slide holding racks 100. wintrobe tube (0 10 marking with metal stand for pcv/esr) 10 tubes 101. coplin jar (vertical) 102. serum storage vial (2 ml capacity) 103. tourniquet 104. disposable mask 105. filter paper 46 x 57 cm 106. cedar wood oil for microscopy 107. plastic slide boxes of capacity 108. plastic slide boxes of capacity 109. test tubes rack 110. test tubes rack 111. test tubes rack 112. test tubes rack ...

Gujarat Medical Services Corporation Limited - Gujarat

23017057 supply of item : pathology diagnostic reagents & kits 1. brilliant cresyl blue 2. potassium dihydrogen phosphate 3. drabkins solution for hb estimation with standard solution 4. deionised water 5. eosin y water soluble 6. giemsa powder 7. glycerol 8. methanol 9. tri sodium citrate liquid 3.2% 10. saponin 11. leishman stain powder 12. sodium dithionite 13. xylene ( sulphur free ) 14. papanicolaou stain kit ready to use, 15. dpx 16. carbol fuschin ( powder ) 17. formalin ( 40% formaldehyde in water ) 18. hydrochloric acid ( 36% ) 19. hematoxyline ( powder ) 20. peraffin wax for histopathology use with ceresin ( melting point 60°c ) 21. sta lia d dimer 22. aluminium alum 23. nitric acid 24. isopropyl alcohol 25. sta ck prest 26. sta neoplastin 27. sta calcium chloride 28. sta dsorbe u 29. sta unicalibrator 30. sta cleaner solution 31. stago cuvettee roll 32. sta lia d dimer control ( system control ) 33. stirrer red 34. stirrer white 35. sodium metabisulphite 36. filter paper whatman grade no. 1 or equivalent 46 x 57 cm 37. dipotassium hydrogen phosphate ( k2hpo4 ) 38. kit for esr ( disposable tube ) 39. reagent kit for aptt 40. reagent kit for prothombin time 41. ependroff cup for stago coagulometer 42. urine strip 3 parameter ( albu, glu, ph ) 43. hematoxylin powder stain certified for microscopy 44. sta fibroprest 45. sta owren color buffer 46. sta factor deficiency viii 47. sta factor deficiency ix 48. sta coolant 49. uri strip for atleast 10parameters ( urine albumin, ph, specific gravity, ketone, urobilinogen, rbc, glucose ) leukocyte, bilirubin nitrite; ascorbate 50. l a reagent 51. control for fibrinogen 52. control for factor viii 53. control for factor ix 54. control for d dimer 55. reagent for la test 56. ( harris ) haematoxylin ( ready to use ) 57. leishmen stain ( ready to use ) with buffers 58. eosin ( ready to use ) 2% solution 59. reticulin stain ( ready to use ) 60. ziehl neelsen ( ready to use ) 61. edta dipotassium 62. hydrogen peroxide 30% 63. sulfur powder 64. lugols iodine 65. methyl violet solution 66. sodium hydroxide pellets 67. sta fdp 68. sta diffiecient factor v 69. sta diffiecient factor vii 70. sta diffiecient factor x 71. immersion oil for microscopy 72. acetone 73. sulphosalicylic acid powder 5 74. trichloro acetic acid liquid 10% 75. liqor ammonia 76. glacial acetic acid aldihide free 77. copper sulphate ( anhydrous ) 78. fouchet reagent 79. barium chloride powder 80. benedicts reagent ( qualitative ) 81. sodium nitroprusside 82. urine container / sputum 83. capillary tube 84. sta fdp calibrator 85. slide tray ( aluminum ) 30x30 cms 86. tissue capsule metal 87. tissue capsule plastic 88. kit for stool occult blood with benzidine powder & hydrogen per oxide 89. microtips ( 20 300 microliter ) 90. microtips 1000 microliter 91. microtips 5000 microliter 92. microtips 100 5000 microliter , yellow color 93. slide boxes of capacity 94. bromocresol blue 95. rbc diluting fluid 96. wbc diluting fluid 97. platelet diluting fluid 98. test tubes rack 99. slide holding racks 100. wintrobe tube ( 0 10 marking with metal stand for pcv / esr ) 10 tubes 101. coplin jar ( vertical ) 102. serum storage vial ( 2 ml capacity ) 103. tourniquet 104. disposable mask...

Health And Family Welfare Department - Gujarat

22971924 purchase of instruments / equipments / chemicals / glasswares / kits / models etc. for p.s.mdepartment 1. aluminium ammonium sulphate 500gm 2. ammonium ceric sulphate 100 gm 3. ammonium molybdate 100 gm 4. ammonium oxalate 500gm 5. ammonium per sulphate mb grade 500gm 6. antisera a 10ml 7. antisera b 10ml 8. antisera d 10ml 9. arsenic trioxide mate chem impex 100 gm 10. barium chloride 500gm 11. bleaching powder 500gm 12. borate buffer solution 500ml 13. brilliant green lactose bile broth 500gm 14. bromocresol green 500gm 15. buffer solution ( ph 10 ) 500ml 16. buffer solution ( ph 4 ) 100ml 17. calcium carbonate 500gm 18. cedar wood oil 125ml 19. concentrated glacial acetic acid 500ml 20. concentrated hydrochloric acid 500ml 21. concentrated sulphuric acid500ml 22. cotton roll 500gm 23. diastix 100piece 24. distilled water 10liter 25. edta 500gm 26. edta vacutainer 100piece 27. erichrome black t100gm 28. ethyl alchol 95% 500ml 29. field stain a 500ml 30. field stain b 500ml 31. filter paper 100piece 32. fufural solution 500ml 33. glove ( 6.5 ) 100piece 34. glove ( 7 ) 100piece 35. hydroxylamime hydrochloride 100gm 36. lancet 100piece 37. macconkey broth with bromocresol purple 500gm 38. mbi kits1 kit 39. methanol 500ml 40. methylene blue solution 100 ml 41. methyl red 100gm 42. muroxide 100gm 43. n / 10 hcl 500ml 44. n / 10 iodine solution125ml 45. needle ( no. 24 ) 100piece 46. nitric acid 500ml 47. pdmab solution100gm 48. petrolium ether 500ml 49. ph strips 100piece 50. phenol 500gm 51. phenol disulphonic acid 500ml 52. phenophthelene 100gm 53. potassium chromate 54. potassium hydroxide 100gm 55. potassium iodate 100gm 56. potassium iodide 100gm 57. potassium nitrate 100gm 58. rapid diagnostic kit for malaria 59. resazurin ( 0.5% ) solution 100 ml 60. resorcinol 250gm 61. rosolic acid solution 100ml 62. silver nitrate 100gm 63. sodium carbonate 100gm 64. sodium chloride 500gm 65. sodium fluoride 100gm 66. sodium hydroxide 500gm 67. sodium hypochloride 500gm 68. sodium thiosulphate 500gm 69. solvent ether 500ml 70. spirit 500ml 71. starch iodide indicator solution 500ml 72. starch powder 500gm 73. starch solution indicator 500ml 74. starillium 500ml 75. syringe ( 2ml ) 100piece 76. syringe ( 5ml ) 100piece 77. tincture iodine 100ml 78. tissue paper 1 roll 79. tryptone water 500ml 80. urine strips 100 strips 81. whatman filter no. 16 100pc 82. zirconium alizarine 100gm 83. zn stain kit 1kit 84. autoclaveutoclave, steel finish, electric, 21 liter. ( size approx. 12 dia. x 12 h ) 85. chloroscoperange : 0.1 ppm 2.0 ppm, capacity : 10 ml for micro titer plate in hot air oven 86. cealing cassettefor micro titer plate in hot air oven capacity : 1 ml, range : 400 700 nm 87. colourimeteraccuracy 0.1 ph, range 0 14, resolution 0.1 ph 88. digital ph meteraccuracy 0.1 ph, range 0 14, resolution 0.1 ph 89. elisa reader with ups apcelisa reader amr 100, back ups 600 apc ( for idine estimaiton in urine ) 90. glucometerglucometer 1 no, lancing device 1 no, lancet, battery, sugar test strip, plastic case 91. horrocks water testing kit1 kit 92. lactometer0 ppm range, 0 degree c temperature, 5 cm x 15 cm, 100 gm weight 93. laminar air flowworking area : 4 x 2 x 2 , size of the filter : 4 x 2 x 6, 1 hepa filter, 1 pre filter 94. magnetic stirrer with hot platesize: 21 x 14.5 cm, heating power: 250w, stirring power: 25w, speed: 0 2400 rpm, power supply : 220v, max. stirring capacity: 2000ml 95. micropipette10 to 100 μl variable 10 to 100 μl variable 96. micropipette1 ml fix 97. micropipette 1 to 10 ml variable 98. micropipette tips1 ml 99. micropipette tips10 ml 100. microscopemonocular 101. microscopebinocular 102. microtitre plateflate bottom 50 103. microtitre plateu bottom 50 104. multi cannel micropipette 105. needle cutterelectric 106. needle cuttermanual 107. nephlometerrange : 0 1000 ntu 108. milk refractometer milk refractometer with auto temperature compensation ( atc ) , range 0 20% with refractive index measurement 109. tds meter with conductivitydigital, dimension: 15.2 x 1.5 x 3.3 cm, height: 33mm, width : 15mm 110. uv spectrophotometer wavelength range : 190 to 1100 nm 111. vortex mixermake biochain 112. water bath dimension : 450 mm x 300mm x 175mm, accuracy : + / 1 degree c 113. beaker 100ml ( glass ) 114. beaker250ml ( glass ) 115. beaker500ml ( glass ) 116. beaker1000ml ( glass ) 117. broomstick100 piece 118. burette25 ml ( glass ) 119. burette50 ml ( glass ) 120. conical flask 100ml ( glass ) 121. conical flask250ml ( glass ) 122. conical flask 500ml ( glass ) 123. coupling jar with lid 100ml ( plastic ) 124. dark brown bottle 500ml ( glass ) 125. dropping bottle 100ml ( plastic ) 126. enamel tray 24 inch×18 inch 127. funnel 50 mm ( glass ) 128. glass marker pen diamond tip pen 129. glass rod 250 mm×6 mm 130. inoculation loop and holder nicrome loop 131. measuring cylinder 10ml ( glass ) 132. measuring cylinder 50ml ( glass ) 133. measuring cylinder 100ml ( glass ) 134. petridish 90 mm x 15 mm 135. pipette with bulb 1ml ( glass ) 136. pipette with bulb5ml ( glass ) 137. pipette with bulb 10ml ( glass ) 138. pipette with bulb 25ml ( glass ) 139. plastic container 2.5 liter ( plastic ) 140. reagent bottle with screw cap 500ml ( glass ) 141. reagent bottle with screw cap 1000ml ( glass ) 142. slide 1 box 143. slide storage box 10 slide 144. slide storage box 25 slide 145. slide storage box 50 slide 146. sputum container 10ml ( plastic ) 147. stainless steel spatula small: 3.3 x 23.7 x 1 cm 148. stainless steel spatulamedium: 5.1 x 25.2 x 1 cm 149. stainless steel tray 18×12 inch 150. sterile glass bottle 300ml ( glass ) 151. test tube 10ml ( glass ) 152. test tube with durhams tube 20ml ( glass ) 153. test tube with lid 20ml ( glass ) 154. volumetric flask 100ml 155. volumetric flask 250ml...

Food And Drug Administration - Gujarat

20556594 supply of chemicals 83. silica gel 60 (adsorbant) (70 230 mesh astm, particle size : 0.063 0.200 mm) 84. tetrabutyl ammonium hydroxide 40% in methanol 85. 4.0 ph buffer solution (nist traceable) 86. 7.0 ph buffer solution (nist traceable) 87. 10.0 ph buffer solution (nist traceable) hplc grade chemicals 1. acetonitrile 2. methanol 3. chloroform 4. tetra butyl ammonium hydrogen sulphate 5. tetra methyl ammonium hydrogen sulphate 6. tert butyl methyl ether 7. triethyl amine 8. 1 3 butandiol 9. water 10. dichloromethane 11. trifluoroacetic acid 12. acetone 13. hexane 14. dimethyl formamide 15. tetrahydrofuran 16. tetra butyl ammonium hydroxide 40% in methanol 17. hexylamine 18. ammonium acetate 19. tetra heptyl ammonium bromide 20. potassium dihydrogen orthophosphate (kh2po4) 21. 1 butanol 22. iso propyl alcohol 23. sodium nitrate 24. di iso propyl amine 25. sodium dihydrogen phosphate 26. potassium hydroxide 27. disodium edetate 28. sodium lauryl sulphate 29. ammonium formate 30. ammonium bisulphate 31. citric acid 32. ammonium carbonate 33. oxylamine 34. glacial acetic acid 35. orthophosphoric acid 36. ammonia strong 37. ethyl acetate 38. 1 propanol 39. toluene 40. cyclohexane 41. sodium perchlorate 42. sodium dodecyl sulphate 43. dioctyl sodium sulpho succinate 44. tetra heptyl ammonium bromide 45. methane sulphonic acid 46. n hexane gc grade chemicals 1. heptafluorobutyric acid 2. cyclohexane 3. toluene 4. ethyl acetate 5. dimethyl sulphoxide 6. dichloromethane 7. acetonitrile 8. methanol 9. acetone gc ms grade chemicals 1. iso octane 2. diethylene glycol 3. dimethyl formamide 4. n hexane 5. glacial acetic acid lc ms grade chemicals 1. ammonium formate 2. ammonium acetate 3. magnesium sulfate 4. ammonium hydrogen carbonate 5. methanol 6. acetonitrile 7. ethyl acetate 8. iso propyl alcohol 9. formic acid 10. acetic acid glacial => open...

Health And Family Welfare Department - Gujarat

19889771 supply of laboratory item procurement for hospital=> open 1 acetate buffer ( ph 5.6 ) ( bsc certified ) 2 acetone ar grade 3 acid fuschin ( bsc certified ) ar 4 activated chorcoal 5 alum ( potassium / aluminium ) ( bsc certified ) ar 6 aluminum potassium sulphate ar 7 ammonium oxalate powder ar 8 ammonium sulphate anhydrous 9 ashipol ( glassware cleaning liq. ) 10 barium chloride powder 11 barium chloride solution 12 bees wax ar 13 benedict’s solution 14 benzidine powder 15 biofix spray 16 boric acid 17 brilliant cresyl blue ( bsc certified ) ar 18 brilliant green ar 19 bromocresol green, 5 gm 20 bromophenol blue, 21 buffer solution ph 4.0 22 buffer solution ph 7.0 23 buffer solution ph 9.0 24 calcium chloride ar 25 carbol fuchsin ( bsc certified ) ar 26 cedar wood oil 27 copper sulphate.5h2o, 500 gm 28 crystal violet ( bsc certified ) ar 29 crystal violet 6b ( bsc certified ) ar 30 d.p.x. ar 31 disodium edta , 500gm 32 disodium hydrogen phosphate ar 33 distilled water a.r. 34 double deionized water 35 drabkin solution with hb standard 36 eosin ( alcohol soluble ) 37 eosin y stain powder ( bsc certified ) ar 38 eosinophil diluting fluid 39 ferric chloride ( bsc certified ) ar 40 filter paper sheet ( minimum a4 size ) 41 formaldyhyde ar 42 formaldyhyde hplc grade 43 fouchet’s reagent 44 fructose reagent for semen analysis ( resorcinol reagent ) 45 giemsa stain powder bsc certified 46 glacial acetic acid 47 glycerine ar 48 haematoxyline stain powder ( bsc certified ) ar 49 haematoxyline stain ready to use solution ( bsc certified ) ar 50 hydrochloric acid ar 51 hydrochloric acid, concentrated, 500 ml 52 hydrogen peroxide ( bsc certified ) ar 53 india ink 54 iso propyl alcohol 55 isopropanolol ( bsc certified ) ar 56 kh2po4 ( monobasic ) 57 liquid paraffin 58 liquor ammonia 59 lugols iodine solution 60 media for semen wash ( swim up technique ) pkt of 20 test 61 methanol 62 methanol acetone free ar 63 methyl orange ( bsc certified ) ar...

Health And Family Welfare Department - Gujarat

19878775 e – tender for rate contract for supply of pathology laboratory consumable items for gujarat adani institute of medical sciences ( gaims ) g. k. general hospital bhuj, kachch, gujarat=> open 140 xylene renkem 141 methanol pure 142 hydrochloric acid 143 leishman stain 144 ammonia solution 145 aluminium potassium sulphate dodecahydrate 146 eosin floresein solution 147 glacial acetic acid 148 hematoxylin 85% pure 149 mercury (ii) oxide 150 histopathology casettes 151 filter paper small size 152 filter paper sheet a 3 paper size big 153 acetic acid glacial extrapure 500 ml 154 hcv rapid test 155 basic fustian 156 oxaric acid 157 iron alum 158 widal a b o h 159 anti a1 sera 160 anti h sera 161 anti human coomb 162 bovine albumin 163 syphilis rapid test 164 rapid fructose reagent...

Health And Family Welfare Department - Gujarat

19132331 supply of medicine surgical items (laboratory 2 and miscellaneous) 67 9063 ziehl neelson ready to use 68 9064 edta dipotassium 69 9065 hydrogen peroxide 30% 70 9066 sulfur powder 71 9067 lugols iodine 72 9068 methyl violet 73 9069 sodium hydroxide pellets 74 9070 sta fdp(for stago sta compact coagulometer) 75 9071 sta defficient factor v (for stago sta compact coagulometer) 76 9072 sta defficient factor vii (for stago sta compact coagulometer) 77 9073 sta defficient factor x (for stago sta compact coagulometer) 78 9074 immersion oil for microscopy 79 9075 acetone 80 9076 sulphosalicylic acid 81 9077 trichloro acetic acid liquid 10% 82 9078 liqor ammonia 83 9079 glacial acetic acid aldihide free 84 9080 copper sulphate anhydrous 85 9081 fouchet reagent 86 9082 barium chloride powder 87 9083 benedicts reagent (qualitative) 88 9084 sodium nitroprusside 89 9089 urine container volume 50 ml 90 9090 capillary tube 91 9091 sta fdp calibrator (for stago sta compact coagulometer) 92 9092 slide tray (aluminum) 30x30 cms 93 9093 tissue capsule metal 94 9094 tissue capsule plastic 95 9095 kit for stool occult blood with benzidine powder & hydrogen per oxide 96 9096 microtips 20 300microliter 97 9097 microtips 1000 microliter 98 9098 microtips 5000 microliter 99 9099 microtips 100 5000 microliter 100 9100 slide boxes of capacity of 100 slide 101 9101 bromocresol blue 102 9103 rbc diluting fluid 103 9104 wbc diluting fluid 104 9105 platelet diluting fluid 105 9106 horiba diluent compactible with hemetology cellcounter model abx micro es 60regulas marketing 106 9107 horiba lyser compactible with hemetology cellcounter model abx micro es 60regulas marketing 107 9108 horiba cleaner compactible with hemetology cellcounter model abx micro es 60 regulas marketing 108 9109 control for compactible with hemetology...

Indian Army - Gujarat

18600297 purchase of drugs and consumables 46 dispo meconium aspirator 47 dispo shephard ventilaion tube 48 dispo spirometry 49 dispo spo2 probes paediatric 50 dispo steam inhaler 51 dispo sterile camera cover for laproscope 52 dispo suprapubic catheter 53 disposable blade for microtome 54 ear drop betnesol n 55 ear drop candibiotic 56 ear drop neosporin h 57 easy phytic acid chemical peel set 58 easy trichloric acid chemical peel set 59 eberconazole creams 1% ( 10gm ) eg eberent 60 endotracheal tube size 8.5mm 61 epistat posterior nasal pack 62 et tube size 3.0 63 et tube size 3.5 64 ethyl alchohol bott of 500 ml 65 eye drop azelastine 0.05% 66 eye drop betadine 5.0% 67 eye drop brinzolamide 1% with mannitol & droptainer system 68 eye drop carboxy methyl cellulose 0.5 % with purite 69 eye drop ciprofloxacin 0.3% 70 eye drop cyclosporine 1% 71 eye drop ketorolac 0.4% 72 eye drop moxifloxacin 0.5% 73 eye drop moxifloxacin hydrochloride 0.5% without preservative with droptainer system fire detection and alarm approved for intracmeral use ( vigamox ) 74 eye drop nepafenac 0.1% 75 eye drop polyethylene glycol + propylene glycol sorbitol with polyquadpreservative 76 eye drop prednosolone acetate 1% moxifloxacin 0.5% + benzalkonium chloride 0.01% ( like apdrops ) 77 eye drop sodium hyaluronate 1mg / ml without preservative ( like eubri ) 78 eye drops bimatoprost 0.03% +timolol 79 eye drops moxifloxacin hydrochloride 0.5% with ketorolac tromethamine 0.5% 80 feeding tube size 6 81 feeding tube size 8 82 fluocinolone acetonide 0.01% sebowash shampoo, 60 ml bottle 83 formaline tablets 84 gargles povidone iodine bott of 100 ml 85 gca ( gycolic acid ) peel 35%, 30ml bott 86 gca ( gycolic acid ) peel 50%, 30ml bott 87 glacial acetic acid bott of 500 ml 88 halobetasol propionate 0.05% w / w , oint tube of 15 gm 89 hcg elisa 4th gen 90 hydrogen peroxide bott of 500 ml 91 inj menotrophin 75iu fsh 92 inj 50 % dextrose...

Navodaya Vidyalaya Samiti - Gujarat

18429113 procurement of sport and games item laboratory item white wash colour wash labour charge tuck shop and coin box hiring of vehicle etc.: 1. acetone 2. ammonium chloride 3. acetanilide 4. acetaldehyde 5. ammonium carbonate 6. methanol 7. phenol 8. sodium hydroxide pellets 9. sodium nitrite 10. bezaldehyde 11. acetic anhydride 12. glacial acetic acid 13. potash alum 14. benzoic acid 15. aniline 16. fehlings reagent ( a+b ) 17. diethyl ether 18. silver nitrate 19. zinc dust 20. potassium iodide 21. liquid ammonia 22. millons reagent 23. phenophthalene indicator 24. methyl orange indicator 25. ph paper 26. litmus paper ( red and blue ) 27. chromatography paper 28. ordinary filter paper 29. molisch reagent 30. laboratory thermometer 31. starch 32. spatualla 33. ninhydrin 34. magnesium chloride 35. diphenylamine 36. ferrous sulphate 37. ammonium molybdate 38. dimethyl glyoxime 39. ammoiumthiocyanate 40. distilled water 1 battery eliminator ( range 1v to 12v ) 2 battery eliminator ( range 2v / 4v ) 3 optical bench with stand 4 potentiometer ( 10 metre wire ) 5 potentiometer ( 10 wire and half metre ) 6 slinky ( sound apparatus ) 7 npn transistor 8 p n junction 9 connecting wire 1 compound microscope 2 dissecting scissors 3 beaker 4 funnel s pipette 6 measuring cylinder 7 measuring cylinder 8 mest tube holder 9 test tube stand 10 test tube 11 dropper 12 dissecting forcep 13 dissecting needle 14 conical flask 15 mitosis all stages slides 16 meiosis all slides 17 e.hystolytica 18 p.vivax 19 ring worm 20 bacteria 21 oscillatoria 22 spirogyra 23 chlamydomonas 24 t.s. of blastulla 25 coverslips 26 glass slides 27 filter paper 28 ph paper 29 chemical for spirit lamp ( spirit ) 30 ethyl alcohol , acetone , petrolium ether ( solvent ) , table bell , chromatography paper...

Health And Family Welfare Department - Gujarat

18146893 supply of laboratory item 1931 kit anti hcv antibody 1932 nacl powder 1933 pan malaria card 1934 kahns test tubes borosilicate 1935 distilled water 1936 wafers for tscd 1937 base molds for embedding rings 1938 base molds for embedding rings 1939 base molds for embedding rings 1940 base molds for embedding rings 1941 embedding ring 1942 azure b dye powder 1943 basic fuschin powder 1944 deionized water for laboratory use 1945 4 amino antipyrine 1946 phenol crystals 1947 bilirubin powder 1948 sulphosalycilic acid 1949 triton x 100 1950 chloritic acid1951 potassium oxalate 1952 sodium fluoride 1953 sodium hydroxide pellets 1954 sodium hydroxide flakes 1955 sodium chloride anhydrous 1956 potassium chloride anhydrous 1957 methanol 1958 butanol 1959 isopropyl alcohol 2.5 lit. 1960 acetone 1961 hydrochloric acid 1962 sulphuric acid 1963 nitric acid 1964 bromocresol green 1965 succinic acid 1966 uricase enzyme 1967 nbt (nitroblue tetrazolium) 1968 sodium cholate 1969 disodium hydrogen phosphate 1970 mops buffer (3 morpholino 2 hydroxy propane sulphonic acid) 1971 10% sodium hypochlorite 1972 acetic acid 1973 glacial acetic acid 1974 bile esculin agar 1975 alkaline cleaning solution 1976 ammonium oxalate 1977 barium chlroride solution 1978 boric acid 1979 dipotassium hydrogen phosphate 1980 dimethyl sulphoxide(dmso)1981 diphenyl 1982 ferric chloride anhydrous 1983 glycerol a.r. 1984 hippuric acid 1985 indicator andrades 1986 indicator bromothymol blue 1987 indicator neutral red 1988 indicator phenol red 1989 indicator universal 1990 indicator methyl orange 1991 indicator methyl red 1992 kovacs indole reagent 1993 paraffin liquid 1994 phenol crystal 1995 potassium dichromate 1996 potassium dihydrogen phosphate, anhydrous 1997 potassium hydroxide crystals/ pellets 1998 potassium iodide 1999 potassium permanganate 2000 potassium tellurite...

Health And Family Welfare Department - Gujarat

16570052 tender for providing laboratory items : pathology, biochemistry and microbiology 30 control low value for micro 60(for horiba abx micros es 60) 31 coomb’s antisera 32 couplin jar plastic 33 cover slips size 22 x 22 mm 34 coverslip box (22x50mm) thickness 0.13 0.17 mm 35 cuvette 36 diluant for micro 60 analyzer (for horiba abx micros es 60) 37 dispo. latex examination gloves size 6.5 38 dispo. latex examination gloves size 7.5 39 disposable apron 40 disposable blood lancets sterile 41 disposable plastic bag red, blue, black 42 disposable plastic pasture pipette 1ml 43 distilled water (107 can, 5 ltr per can) 44 dpx (250 ml) 45 emersion oil (100 ml per bottle) 46 eosin stain (2% 500 ml) 47 esr tube 48 eye wash facility 49 field stain a 500ml ready to use 50 field stain b 500ml ready to use 51 filter paper sheets  46 x57 cm. 500 no, / pkt 52 fouchet’s reagent (125 ml) 53 glacial acetic acid lr 54 glass beakers 1000ml 55 glass beakers 500ml 56 glass marker pen (black) 57 glass marker pen (blue) 58 glass slide 75 x 25 x 1.1 ml 59 glass thermometer ( 10 to 50 c) 60 glucometer strip (one touch select ) (simple) 61 haematological capillary for bt ct 62 haematoxylin stain 63 hbsag rapid (100 test per kit) 64 hcl (concentrated) 65 hcv rapid (100 test per kit) 66 hematological control set with reference value for nihon kohden celltac e (5 part),  third party biorad, span, randox(except nihon kohden), containing low, normal, high level control 67 hiv combaids/ immunocomb (100 test per kit) 68 hiv rapid (100 test per kit) 69 hypochlorite solution 5% 70 lab wash solution 71 label stickers large size 72 leishman stain 73 liquid hand wash 74 lyser for micro 60 analyzer (for horiba abx micros es 60) 75 malaria p falci and p vivax antigen card 76 may grunward’s stain for cytopathology himedia, merck, span 77 medicated cotton roll 78 medicated soap dettol,savlon, lifeboy ...

Navodaya Vidyalaya Samiti - Gujarat

12295561 supply of science lab equipments 1 p n junction characteristic appartus ( analog ) 2 battery elimininator ( 0 6 ) v 3 copper wire wraped with thread ( white ) 4 wire cutter 5 conc. h2so4 6 hcl 7 hno3 8 ethanol 9 glacial acetic acid 10 pipete 20ml. 11 test tube stand 12 burrate farinol ( keep finnol ) 13 cavity slides 14 cover slip 15 scurose 16 boric acid 17 magnesium sulphate 18 potassium nitrate 19 hand lens 20 meshes of different pores size 21 measuring cylinder 22 funnel 23 ph paper 24 dropper 25 scissors 26 forceps ( pointed ) 27 methyk alcohol 28 brush ( staining ) 29 storch 30 enzymes cellulase 31 enzymes protease 32 ribonuclease 33 lipases 34 ethanol 35 spool ( reel for winding yash 36 t.s. of testes ( mammats ) 37 t.s. of ovarics ( mammats ) 38 meiosis set onian 39 meiosis set gueshopper 40 t.s. of blestula 41 pea seed 42 pedigree charts 43 rolling to urge 44 ididow peak 45 colour blindness 46 binasculatwo model / charts 47 museus specimen entaunoebah 48 plasmodium vivax 49 ascaris male 50 ascaris female 51 millians reagent 52 split cork 53 unrease 54 sodium hypolanude 55 bacterial coil 56 nostoc 57 permenent slide t.s. of irone 58 t.s. of cartiloge 59 muscular tissue 60 elithelial tissue...

Navodaya Vidyalaya Samiti - Gujarat

12228470 supply of laboratory items 1 spirit lamp 2 beaker 3 test tube ( 5 x 5 / 8 ) 4 wire gauge 5 chromatography paper sheet 6 ganongs potometer 7 haemocytometer 8 acetic acid 9 acetocarmine 10 benedict solution 11 eosine solution 12 fehling solution a 13 fehling solution b 14 glycerine 15 hydro chlorid acid 16 iodine crystal 17 iodine solution 18 isoproply alcohol 19 litmus paper 20 magnesium sulphate 21 methanol 22 methylene blue 23 millons reagent 24 saffranine solution 25 starch 26 sucrose 27 sudan iii 28 sulphric acid 29 p.h.paper 30 p.h.tablet 31 potassium nitrate 32 potassium iodide 33 glacial acetic acid 34 picric acid 35 chloroform 36 phenophthalene 37 spirit 38 enzymes cellulase, protease ribonuclease and lipase chemical lab: 1 burette ( 50 ml ) 2 burette stand and clamp 3 test tube 4 test tube holder 5 electronicweightmachine 6 acetone 7 ammonioum chloride 8 ammonioum carbonate 9 atomicsolidstructuremodel 10 forceps 11 carbon tetra chloride 12 nitrobenzere 13 urea 14 carbon di sulphide 15 lead nitrate 16 conial flask 100 ml 17 starch 18 cork ( rubber ) 19 pipette 20 ml 20 bayers reagent physics lab : 1 archemedes principal set 2 lecopodium powder 3 lens and mirrors holders, screen focal length 10 15 cm 4 npn or pnp transistor kit 5 mirror holder 6 unknown resistance 7 zener diode characteristics apparatus 8 p n junction diode characteristics with four meters and two power supplies with connecting leads....

Employees State Insurance Corporation - Gujarat

9290292 supply of item laboratory kits, laboratory chemicals, laboratory glass wares and miscellaneous items 1 esr tube with cap 2 test tube 12 x 75 mm 3 cover slip 22 x 22 mm ( thickness 0.13 – 0.16 mm ) 4 cover slip 22 x 50 mm 5 capillary tube for bt, current transformer 6 micro glass slide ( 76 x 26 x 1.3 mm ) 7 micro glass slide ( frosted 75 x x 1.3 mm ) 8 micro tips ( 5 to 100 micro liter ) 9 micro tips ( 100 to 1000 micro liter ) 10 glucose powder 11 disposable cuvette for rx50 12 micro pipette fix ( 10 micro liter ) 13 micro pipette fix ( 20 micro liter ) 14 micro pipette fix ( 50 micro liter ) 15 micro pipette variable ( 100 to 500 micro liter ) 16 micro pipette varible ( 500 to 1000 micro liter ) 17 micro pipette fix ( 100 micro liter ) 18 micro pipette fix ( 25 micro liter ) 19 tissue paper roll ( large size ) 20 lens cleaning tissue paper 21 k3 edta vacutainer ( 2 ml ) 22 clot activator vacutainer ( 4 ml 23 fluoride vacutainer ( 2 ml ) 24 3.2 perc. citrate vacutainer for potential transformer ( 4 ml ) 25 vacutainer needle with holder 26 esr stand 27 cotton 28 savlon 29 sterilium 30 5 ml syringe with 23 g needle 31 5 ml syringe with 22 g needle 32 10 ml syringe with 22 g needle 33 permanent marker 34 stickers 1 x 2 cm 35 stickers 2 x 4 cm 36 sterile urine container 37 tourniquet 38 filter paper 39 lancet 40 coplin jar ( plastic ) with cover 41 coplin jar ( glass ) with cover 42 slide storage box ( 50 slide ) 43 slide storage box ( 100 slide ) 44 aluminium slide tray 45 aluminium t t rack ( 48 holes ) 46 slide staining rack with handle 47 slide staining bath ( glass ) 48 aluminium perforated box square 49 tooth forcep 50 disposable cap 51 disposable mask 52 bmw bag 53 bmw buckets foot operated 54 bmw stickers 55 ziplock bag ( 4x 6 ) 56 thermocoal box for sample transportation 57 measuring cylinder 500 ml ( glass ) 58 measuring cylinder 1000 ml ( glass ) 59 beaker – 250 ml ( glass ) laboratory chemicals 1 methanol lr 2 normal saline liquid 3 xylene lr 4 eosine powder lr ( yellow ) 5 sulphasalicylic acid lr 6 reticulocyte count soln. ready to use 7 conc. hcl 8 hcl 0.1 n 9 deionised water 10 glycerol lr 11 nitric acid conc. 12 haematoxyline powder or crystals 13 h2o2 30perc. 14 barium chloride 10perc. lr 15 acetic acid lr 16 banedicts soln. 17 cedar wood oil ( ri: 1.515 1.516 ) 18 fouchets reagent 19 lugols iodine 20 formaline ( conc. ) 21 sodium citrate 3.8perc. 22 sodium metabisulphide 23 sodium hypoclorite 1perc. 24 absolute alcohol 25 benzidine powder 26 field stain – a ( ready to use 27 field stain – b ( ready to use 28 glass marker pen 29 gloves 6.5 number 30 gloves 7 number 31 gloves 7.5 number 32 dropper bottle 250 ml ( pc 33 dropper bottle 500 ml ( pc 34 funnel glass 35 porceline tray with lid ( small 36 porceline tray with lid ( medium ) 37 ammonium or potassium alum 38 mercuric oxide 39 glacial acetic acid kits: 1 blood glucose auto kit 2 blood urea 3 s creatinine 4 s hdl cholesterol 5 s triglyceride 6 s total protein 7 s albumin 8 s cholesterol 9 s billirubin 10 sgpotential transformer auto kit 11 s alkaline phosphatase 12 s cpk 13 sgot 14 s sodium 15 s potassium 16 s chloride 17 s phosphorous 18 s amylase 19 s calcium 20 s uric acid 21 s g6pd 22 aso 23 rpr 24 s widal 25 r a factor 26 hbsag ( rapid ) 27 crp ( card ) 28 hcv ( rapid card ) 29 upotential transformer ( strip ) 30 hiv 1 & 2 ( rapid card ) 31 csf protein 32 antisera ( a, b, d ) with dropper 33 bovine albumin 34 coombs sera 35 dengue kit ( igg, igm, ) 36 dengue kit ( ns1 ) 37 uristick ( albumin & glucose ) 38 uristick ( glucose ) 39 uristick ( multistick ) 40 flow cell cleaning solution for rx 50 41 s trop i 42 spot test for occult blood 43 drabkins reagent with std. 44 s cpk mb 45 acetone powder 46 s ldh ( auto kit ) 47 s lipase 48 s magnesium 49 rapid pap stain kit...

Central University Of Gujarat - Gujarat

7890541 rate contract for supply of laboratory chemicals, glass ware, plastic ware & miscellaneous items at cug plastic ware 1. 100 mm dish 2. 60 mm dish 3. 35 mm dish 4. t 75 cm2 flask 5. t 25 cm2 flask 6. 96 well plates 7. 96 well plates (non coated) 8. 48 well plates 9. 24 well plates 10. 12 well plates 11. 6 well plates 12. 50 ml tube 13. 15 ml tube 14. 2 ml micro centrifuge tube 15. 2 ml micro centrifuge tube (amber) 16. 1.5 ml eppendorf tube 17. pcr tube 18. 10 ml serological pipettes 19. serological pipettes 25 ml 20. cryo vials 21. 1 ml pipette tips 22. 20 200 μl pipette tips 23. 2 20 μl pipette tips 24. 5 ml pipette tips 25. autoclave bags 26. biohazard bags (big black bags) 27. confocal chamber slides 28. confocal cover slip 29. cryobox (25 well) 30. cryobox (96 well) 31. pcr tube box 32. cell lifter 33. cell scraper 34. fibronectin coated well plate 35. reservoirs 36. cryoboxes 5x5, 37. cryoboxes 12x8 38. conical tubes – 15 ml 39. conical tubes – 50 ml 40. serological pipettes – 10 ml 41. t75 flask 42. t25 flasks 43. tissue culture plates 100 mm 44. tissue culture plates 60 mm 45. tissue culture plates 35 mm 46. 6 well plate 47. 12 well plate 48. 24 well plate 49. 48 well plate 50. 96 well plate non treated 51. 96 well plate black 52. microcentrifuge tube (2 and 1.5 ml) 53. ultra centrifuge tube 54. centrifuge tube (2 and 1.5 ml) 55. cuvettes for electroporation 56. cuvettes for spectrophtometer 57. pcr tube 58. micropipettes tip (0.5, 200, 1000 and 59. cryobox 60. pcr tube box 61. culture glass flask 62. plant tissues culture tube 63. filter paper 64. bacterial culture tube, glass ware 1. pasteur pipettes 2. facs tube 3. borosil bottle 500 4. borosil bottle 1000 5. glass bottles 250 ml 6. facs tubes, cell culture media and other 1. fbs 2. syringe filter (0.2 u) 3. media filter (0.2 u) 4. rpmi (without hepes) 5. rpmi (without glucose) 6. dmem f12 7. dmem (low glucose) 8. dmem (without glucose) 9. dmem (high glucose) 10. hams f 12 (high glucose) 11. huvec media (part a+part b) 12. huvec media (part a) 13. reagent pack subculture reagent for saec cells 14. calcium free media 15. mem 16. hams f 12 17. mebm media 18. himesoxl mesenchymal stem cell expansion medium, reduced serum 19. cryo vials 20. autoclavable bags 21. rpmi (without hepes buffer) 22. mem 23. fetal bovine serum (fbs), antibiotics 1. penicillin+streptomycin pentrap antibiotic solution 2. antimycotic, 1. penicillin+streptomycin pentrap antibiotic solution 2. antimycotic 1. trypsin 2. rtase 3. taq polymerase 4. poly (a) polymerase 5. taq polymerase 6. rtaase 7. pngase 8. enzymes (re, ligase polymerase, etc), general chemicals and reagent 1. hepes 2. sodium pyruvate 3. chloroform (moleculannual/repair grade) 4. isopropyl alcohol (moleculannual/repair grade) 5. ethanol 6. ethyl alcohol (moleculannual/repair grade) 7. methanol 8. tris base 9. glycine 10. ecl solution 11. fixer 12. developer 13. dmso 14. mtt dye 15. bradford reagent 16. ammonium persulfate (moleculannual/repair biology grade) 17. acrylamide 18. bis acrylamide 19. sodium chloride 20. tween 20 21. etbr 22. agarose 23. hcl 24. naoh 25. trypan blue 26. dcfda 27. n acetyl cystine 28. h2o2 29. lipopolysaccharide from e.coli 30. dextran sulphate sodium salt (36500 50000 m wt) 31. acacetin 32. ponceau 33. annexin v 34. propodeum iodide 35. sterile glucose 36. 4perc. buffered paraformaldehyde, 37. glacial acetic acid 38. acetic acid 39. acetone 40. sds 41. sybr green rt pcr 42. evodiamine 43. rotenone 44. diphenyleneiodonium chloride (dpi) 45. lipofectamine 2000 transfection reagent 46. fibronectin lyophilized powder 47. s ampa 48. 3 methyladenine 49. trizol 50. h2so4 51. sodium chloride 52. tween 20 53. skim milk defatted milk powder 54. trypan blue dye 55. annexin v fitc 56. 57. sheath fluid 58. pha l (l phytohemagglutinin) 59. pha e (e phytohemagglutinin) 60. con a (concanavalin a) 61. swainsonine 62. cycloheximide 63. actinomycind 64. trypsin 65. penicillin+streptomycin pentrap antibiotic solution, 66. amphotericin antimycotic solution 67. cell scraper 68. sulpho nhs 69. mes monohydrate 70. dmso 71. edac 72. thionyl chloride 73. rink amide (aminomethyl)polystyrene 74. annexin v : pe apoptosis detection kit 75. egfr antibody (528) alexa fluor® 647 76. cdcl3 (chloroform d) nmr solvent 77. dextran from leuconostoc spp. mr ~70,000 78. gel filtration standard lyophilized 79. polycaprolactone, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 120. syringes 1 ml 121. syringes 2 ml 122. syringes 5 ml 123. syringes 50 ml 124. stainless steel forceps (blunt ) 125. stainless steel forceps (pointed) 126. cryogenic vial sterile 2.0 ml 127. ph paper 2 10.5) 128. parafilm m usa 129. glass slides standard grade 130. microscope cover glass standard grade 131. sterile scalpel blade no.11 132. stainless steel scalpel holder no.3 133. stainless steel forceps (blunt ) 134. stainless steel forceps (pointed) 135. standard mambrane filter (0.22um) 136. pipette fillers 137. sybr green 138. taqman probe 139. sequencing chemicals 140. primer synthesis 141. antibiotics 142. cloning vectors (plasmids) 143. bacterial cells 144. membranes for blotting 145. rt pcr and pcr chemicals 146. moleculannual/repair markers 147. bacterial culture media 148. plant tissue culture media 149. dyes 150. petri dish plates 151. trizmabase, tris 152. ethanol, methanol 153. edta 154. naoh 155. potassium acetate 156. sodium acetate 157. glacial acetic acid 158. propanol 2 159. chloroform 160. isoamyl alcohol 161. agarose 162. ethidium bromide, 163. bromophenol blue 164. sodium chloride 165. magnesium chloride 166. sodium doecyl sulfate 167. glycerol 168. iptg 169. x gal 170. solarite soils for tissue culture, antibody 1. gapdh abs 2. secondary antobody anti mice 3. secondary antobody anti rabbit 4. actin abs 5. lamin abs 6. alexa fluor 488 anti mouse 7. alexa fluor 568 anti rabbit 8. 9. anti egfr antibody 10. anti phospho egfr antibody (y1173) 11. vwf abs 12. brcc36 antibody 13. hmgcr antibody 14. cox 2 antibody 15. laminb1 antibody 16. p 21 antibody 17. cox 2 (complex ii) abs mitochondrial loading control 18. anti tubulin(tu 02) antibody 19. zeb 1 antibody 20. twist antibody 21. phospho chk1 (ser 345) (133d3) 22. total chk1 23. rad51 24. glutamate receptor 1 antibody 25. phospho p38 mapk (thr180/tyr182) 26. p38 mapk antibody, kit 1. human inflammation array q1 2. lipoxygenase inhibitor screening assay kit 3. hegf recombinant protein 4. insulin eliza kit 5. prostaglandin e2 (pge2) eia kit – monoclonal 6. dual luciferase® reporter assay system luciferase assay kit for nf κb 7. saec cells growth medium bullet kit 8. 8 ohdg elisa kit 9. griess reagent 10. prostaglandin e2 (pge2) eia kit monoclonal 11. kinase assay kit 12. glutamate release assay kit 13. growth factor kit 14. temphil rchartered accountant kit 15. ta cloning kit 16. gel extraction kit 17. miniprep kit 18. midiprep kit 19. rna and rnai isolation kit 20. dna isolation kit 21. protein isolation kit 22. pcr purification kit, inhibitor 1. phosphatase inhibitor 2. protease inhibitor 3. rnase inhibitor 4. actinomycin d 5. cyclohexamide (chx) 6. ns398 – cox 2 inhibitor 7. myxothiazol, primers/oligo dt 1. gapdh primer 2. primers: (1) human cysteinyl leukotrine receptor 1 (hcyslt1 receptor): n terminal / r1 forward, 5 atggatgaaacaggaaatctgacag 3; c terminal / r1 reverse, 5 cctcttctttatacatttcatatc 3 (2) human cysteinyl leukotrine receptor 2 (hcyslt2 receptor): n terminal / r2 forward, 5 accttcagcaataacaacagc 3; c terminal / r2 reverse, 5` cgtttctgtctgacgtatttc 3 3. rt primer (degenerate rt primer) for mirna, (hplc grade) sequence: 5’caggtccagtttttttttttttttvn3’ where (v=a, c and g), (n=a,c,g and t) 4. mir143 primer 5. u6 snrna primer 6. hmgcr primer 7. 8. primers for sirna p21 9. primers for sirna p27 10. primers for sirna control 11. cd1d primers 12. cd1d sequencing and analysis through maldi tof 13. cyclin e primer 14. cdk2 primer 15. si rna cyclin 16. si rna cdk2 life technologies (#1 ggagcuuaaccauccuaautt 3 ggaaguuucaguauuagautt 17. oligo dt 18. gnt iii primer and gnt v primer (for rt pcr and cloning) 19. integrin beta3 and beta6 primer (cloning) 20. sirna 21. e cadherin rt pcr primers 22. n cadherin rt pcr primers, 23. vimentin rt pcr primers 24. integrins rt pcr primers 25. laminin rt pcr primers 26. collagen rt pcr primers 27. fibronectin rt pcr primers 28. egfr rt pcr primers 29. pcna rt pcr primers 30. p53 rt pcr primers 31. hif1α rt pcr primers 32. vegf rt pcr primers, 23. vimentin rt pcr primers 24. integrins rt pcr primers 25. laminin rt pcr primers 26. collagen rt pcr primers 27. fibronectin rt pcr primers 28. egfr rt pcr primers 29. pcna rt pcr primers 30. p53 rt pcr primers 31. hif1α rt pcr primers 32. vegf rt pcr primers, proteins/ladder 1. precision marker western blotting 2. 100bp dna ladder 3. hegf recombinant protein 4. visfatin (mouse) protein 5. human ldl 6. il 1beta human recombinant protein 7. precision marker western blotting, cells 1. saec cells 2. human adipose derived mesenchymal stem cells, miscellaneous 1. gloves 2. blotting paper (western) 3. face mask 4. blotting paper 5. tissue rolls 6. x ray films, 7. skim milk defatted milk powder 8. parafilm 9. biohazard bags (big black bags) 10. pvdf membrane 11. co2 cylinder 12. liquid nitrogen 13. syringe filter 14. blotting paper 15. autoclave bags 16. mask 17. blotting paper 18. autoclavable bags 19. tissue rolls 20. phstrip 21. phstrip 22. phstrip 23. phstrip 24. freeze tag transparent 25. freeze tag 26. freeze tag, white lable 27. ph eletrode, 1. nitrogen gas 2. zero air gas 3. helium gas 4. argon gas 5. carbondioxide gas 6. acetylene gas 7. oxygen gas 8. nitrous oxide gas 9. hydrogen gas 10. liquid nitrogen gas 11. liquid helium gas, 1. beaker 5ml 2. beaker 10 ml 3. beaker 25ml 4. beaker 50ml 5. beaker 100ml 6. beaker 250ml 7. beaker 500ml 8. beaker 1000ml 9. round bottom flask 10ml 10. round bottom flask 25ml 11. round bottom flask 50ml 12. round bottom flask 100ml 13. round bottom flask 250ml 14. round bottom flask 500ml 15. round bottom flask 1000ml 16. volumetric flask 5ml 17. volumetric flask 10ml 18. volumetric flask 25ml 19. volumetric flask 50ml 20. volumetric flask 100ml 21. volumetric flask 250ml 22. volumetric flask 500ml 23. volumetric flask 1000ml 24. conical flask 50ml 25. conical flask 100ml 26. conical flask 250ml 27. conical flask 500ml 28. burette 25ml 29. burette 10ml 30. sample vial 5ml, 31. sample vial 15ml 32. sample vial 30ml 33. sample vial 10 ml 34. funnel different size 35. watch glass different size 36. petri dish different size 37. buckner funnel 38. filtration flask 60ml 39. filtration flask 125ml 40. filtration flask 250ml 41. glass road 42. dropping bottle with different size 43. measuring cylinder 5ml 44. measuring cylinder 10ml 45. measuring cylinder 25ml 46. measuring cylinder 50ml 47. measuring cylinder 100ml 48. pipette 1ml 49. pipette 2ml 50. pipette 5ml 51. pipette 10ml 52. pipette 25ml 53. wire gauge for lab 54. test tube rack with diff. shapes 55. test tube with different size 56. condenser with different size 57. column with different size 58. separating funnel 50ml 59. separating funnel 100ml 60. separating funnel 250ml 61. glass dropper 62. melting tube 63. capillary tube 64. cotton 65. characterization dishes (glass water bath) with different size 66. desiccator with different size 67. a 1, reduction adapters socket 14/23 cone 19/26 68. a 1, reduction adapters socket 14/23 cone 24/29 69. a 1, reduction adapters socket 14/23 cone 29/32 70. a 1, reduction adapters socket 19/26 cone 24/29 71. a 1, reduction adapters socket 19/26 cone 29/32 72. a 1, reduction adapters socket 24/29 cone 29/32 73. a 2, expansion adapters socket 19/26 cone 14/23 74. a 2, expansion adapters socket 24/29 cone 19/26 75. a 2, expansion adapters socket 24/32 cone 14/23 76. a 2, expansion adapters socket 29/32 cone 24/29 77. a 2, expansion adapters socket 29/32 cone 19/26 78. a 2, expansion adapters socket 29/32 cone 14/23 79. a 9, cone adapters, straight connection with stopcock, cone 14/23 80. a 9, cone adapters, straight connection with stopcock, cone 19/26 81. a 9, cone adapters, straight connection with, stopcock, cone 24/29 82. b 24, dropping bottles with pipette stopper, cap diff. sizes 83. silicon oil (for oil bath 250+0c) 84. round/octagon magnetic stirrer bannual/repair with pivot ring diff sizes 85. clamp diff size and shape 86. clamp stand 87. bosshead diff size and shape 88. magnetic retriever 89. tlc plates (merck) 90. distillation condenser with diff size 91. dishes crystallizing (oil bath) with diff size 92. glass stopper hexagonal/ round with diff neck size 93. syringe (0 50 μl) 94. tlc capillary 95. tlc chamber 96. bottles, dropping with pipette & rubber teat with diff sizes 97. vetro clean 98. flasks, filtering, bolt neck, with tubulation (250 ml) 99. dishes 100 x 50 100. dishes, culture, petri 50 x 17 101. micro centrifuge tubes (500015, 500017) 102. semi micro buchner funnel 103. magnetic bead 104. sample vial 10ml 105. centrifuge tubes: 500031 500041, etc....