Department Of Pharmaceuticals - Gujarat

34006615 annual rate contract for supply of consumable items for the financial year 2022 23 1 chemicals and solvents laboratory grade chemicals, fine chemicals, bio chemicals, molecular biology grade chemicals, analytical grade chemicals, solvents, organic intermediates, reference standards and speciality fine chemicals ( ar / nmr / hplc / gc grades ) 2 bulk solvents ( 25 litre packing ) laboratory grade ( lr ) solvent commonly used in labs such as ethyl acetate, hexanes, acetone, chloroform, methanol, dichloromethane, petroleum ether 60 80, etc 3 laboratory glasswares glasswares used in chemistry, biology, and analytical laboratories 4 plastic wares general plastic wares for commonly used in chemistry, biology, and analytical laboratories, microtips, microcentrifuge tubes dnase / rnase, pyrogen free, sterile and cell culture plasticwares 5 general lab wares metalwares and rubber wares commonly used in chemistry, biology, and analytical laboratories, magnetic stirring beads, mask, gloves, biohazardbags, autoclave bags, shoe covers, pp kit, syringe filters, membrane filters, filter papers, filter paper thimbles, syringes, silicone rubber vaccum tubes, etc 6 antibodies primary, secondary antibodies for westernblot, flowcytometry, ihc, ic, 7 culture media cell culture media, reagents and growth factors, pathogen culture media, stem cell culture media 8 molecular and cellular biology items oligos, sirna, shrna, transfection / electroporation reagents, cell separation consumables, dna / protein electrophoresis / nucleic acid purificationreagents, crispr genome engineering reagents, vectors, plasmids, ips cells, inhibitors, proteins, recombinant proteins, neurotrophins, , hormones, natural proteins, viral antigens, cd antigens, chemokines, compound libraries, etc., pcr and qpcr, enzymes / restriction enzymes, diagnostic and research kits for molecular and cellular biology ( elisa, next generation sequencing library preparation kit, tapestation reagents and consumables, kinase assay etc ) flowcytometry reagents, pcr and qpcr, dna and rna oligonucleotides. 9 animal house consumables animal feed, isoflurane, animals ( rats sprague dawley, wistar, lewis ) , mice ( c57bl / 6, icr, balb / c, cd 1 nude mice, nod scid ) and animal bedding, drape 10 laboratory gases refilling of gases ( co2, o2, nitrogen ( uhp ) 99.999% gas, argon ( uhp ) 99.999% gas, zero air gas, hydrogen ( 99.999% ) gas, helium ) , liquid nitrogen gas 1 chemicals / solvents ( hplc grade, mass grade, deuterated solvents ) , chromatography columns consumables merck ( sigma aldrich, milipore ) , tci chemicals, qualigens, qiagen, qualikems, spectrochem, thermo fisher scientific, alfa aesar, fluka, across, sd fine chemicals, avra, cdh, cambridge isotope, eurisotop, himedia, jt baker, finar, srl chemicals, loba chemie, chemimpex, rankem ( avantor ) , waters, agilent, phenomenex, whatmann, kromasil, otto chemie, strem chemicals, synmr 2 glasswares borosil, corning, jsgw, riviera, duran, dwk, glassco, asgi, axiva, cole parmer, vwr, brand gmbh, sigma aldrich, tarson, thermo fisher scientific, fisherbrand, sabar scientific, rasayan 3 plastic wares and general lab wares bd falcon, bio rad, corning, thermo fisher scientific, brand gmbh, axiva, merck, polylab, tarson, eppendorf, abdos, borosil, cole parmer, vwr, polylab, whatman, genetix, genaxy, riviera, glassco, duran, asgi, borosil, sabar scientific, rasayan 4 molecular and cellular biologyenzymes, reagents and kits / biochemical / immuno chemicals abcam, ambion, amresco, axygen, bd biosciences, biorad, genaxy, corning, eppendorf, genscript, imgenex, thermo fischer scientific, invitrogen, fermentas, novagen, perkin elmer, merck life science, qiagen, lonza, takara, qualigens, sigma, promega, new england biolabs, promocell, srl, hi media, synbio, santa cruz, cytiva, trivector biomed, integrated dna technologies, agilent, cell signalling technology, novus biologics, r and d signalling, sigma aldrich, alomone lab, vector lab, anaspec, wako, atlas, genetex, symport, cayman, diagenode...

Department Of Science And Technology - Gujarat

33483331 bids are invited for agar powder, bacteriological grade 500gm , bushnell haas broth 500gm , cetrimide agar base 500gm , candida differential agar 100gm , universal differential medium 500gm , kf streptococcal agar base 500gm , luria broth 500gm , m endo agar les 500gm , m fc agar base 500gm , macconkey agar 500gm , mueller hinton broth 500gm , nutrient broth 500gm himedia , r2a agar 500gm , sabouraud dextrose broth 500gm , ss agar 500gm , sheep blood agar base 500gm , soybean casein digest 500gm , leeds acinetobacter base 500gm , amphotericin b 1gm , ampicillin sodium salt 5g , cefotaxime sodium salt 5gm , cefoxitin suppl 5vl , ceftazidime pentahydrate 1gm , ceftriaxone sodium salt 1gm , chloramphenicol 5gm , ciprofloxacin hcl monohydrate 5gm , clindamycin hcl 5gm , colistin sulphate 1gm , erythromycin 5gm , fluconazole 5gm , gentamicin sulphate 5gm , meropenem suppl 5vl , oxacillin resi selective suppt 5vl , polymyxin b selective suppl 5vl , rifampicin rifampin 1gm , tetracycline hcl 5gm , trimethoprim 5gm , vancomycin hcl 1gm , sulphamethoxazole 25gm , amphotericin b , ampicillin , cefotaxime , cefoxitin , ceftazidime , ceftriaxone , chloramphenicol , ciprofloxacin , clindamycin , colistin methane sulphonate , co trimoxazole sulpha trimethoprim , erythromycin , fluconazole , gentamicin , imipenem , linezolid , meropenem , oxacillin , polymyxin b , rifampicin , tetracycline , trimethoprim , vancomycin , lysozyme 5gm , sterile discs , phenol solution 500ml , pbs ph 7.4 100gm , cellulose nitrate membrane, sterile , beaker 1000ml autoclavable pp , measuring beaker 500ml , conical centrifuge tube rack 50 ml , 250 ml measuring cylinder , parafilm , centrifuge tube reversible rack with cover , rpp autoclavable test tube stand , petridish with triple vent radiation sterile , 0.2 10 micro tips ul pp , micro tips 200ul , micro tips 1000ul , 1.5ml micro centrifuge tube , micro tip box 0.2 10ul 96 places 10 nos , micro tip box tips 2 200 ul , micro tip box tips 200 1000ul , 15ml tube conical bottom sterile , pcr tubes, flat cap, clear 0.5 ml , mctube 1.5ml, low retention , 20ul low retention nonsterilized , 200ul bevelled natural low retention , acetic acid glacial ar grade, 2.5l , ammonia solution acetic acid glacial ar grade, 2.5l , ammonia solution 500ml , buffer capsules ph 4 , buffer capsules ph 7 , buffer capsules ph 9.2 , dmso 500ml , potassium phosphate 500gm , sodium chloride ar 500gm , orthophosphoric acid 500ml , potassium permanganate 500gm , potassium dihydrogen orthophosphate 500gm , sodium hydroxide 500 gm , nuclease free water 500ml , agarose 100 gm , trizol reagent 100 ml , diethyl pyrocarbonate 25gm , potassium chromate 250 g , potassium dichromate 500 g , flasks conical 100 ml , conical flasks 250 ml , conical flasks 1000 ml , glass beaker 1l , glass beaker 250 ml , measuring cylinder 100 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , media bottles 250 ml , media bottles 500 ml , media bottles 1000 ml , test tube 25 x 150 , voumetric flask 100 ml , petri dish 90 x 15 , pipette 10 ml , volumetric flask amber coloured 10 ml , pcr readymix, 6ml , membrane filter 0.22 um , qpcr mastermix, 1ml , tris, free base 500gm , edta disodium salt dihydrate 500gm , chloroform 500ml , 2 propanol 1lt , syringe filters pvdf 0.22um , ethidium bromide 1gm , 50ml screw cap tube autoclavable , pipette controller 1 100ml , mce membrane individually packed , test tube o. d. 25 mm plugs, autoclavable , test tube o. d. 38 mm plugs, autoclavable , bod bottle 300 ml , conical flasks 500 ml , ipa 2.5l , forceps , spatula , isoniazid 5gm , glycerol mb grade, 500ml , gel loading buffer for dna 5ml , aspirator bottle with stopcock 5 l pp, autoclavable , d glucose 500gm , yeast extract 500gm , potassium acetate 250gm , fluid thioglycollate medium, 500gm , hydrochloric acid, ar grade 500ml , 100 bp dna ladder, 50lanes , 1kb dna ladder, 50lanes , ethyl acetate 500 ml , methanol for hplc 500 ml , funnels glass 100ml , sodium acetate...

Ahmedabad Municipal Corporation - Gujarat

32502473 annual rate contract for supply of laboratory chemicals, glassware’s and miscellaneous articles to thepublic health laboratory of ahmedabad municipal corporation, year 2022 23. acetone, acetic acid ( glacial ) ( aldehyde free ) , acetic acid, acetonitrile, alluminium oxide basic, ammonia, iso amyl alcohol, antimony trichloride, boric acid, boron try flouride, carbon tetra chloride, chloroform, copper sulphate, formaldehyde, furfuraldehyde, fehling a, fehling b, glycerine, con. hydrochloric acid, iodine monochloride, isopropanol ( iso propyl alcohol ) , isopropanol ( iso propyl alcohol ) , isopropanol ( iso propyl alcohol ) , methanol, methanol, con. nitric acid, nitric acid, n hexane, n hexane, n heptane, pera dimethyl amino benzaldehyde ( pdab ) , petrolium ether ( 60 80°c ) , petrolium ether ( 40 60°c ) , phenolphthalein, potassium chromate, potassium dichromate, potassium iodide, potassium hydrogen phthalate, solvent ether ( diethyl ether ) , sodium hydroxide, sodium oxalate, sodium thiosulphate, starch soluble, con. sulphuric acid, sodium carbonate, silica gel for moisture, sodium bicarbonate, sodium chloride, sodium methoxide, teepol, fame mix std ( for gc ) , ph buffer solution 4.00, ph buffer solution 7.00, ph buffer solution 9.2, 84 us / cm @ 25 deg conductivity solution, sodium chloride volumetric standard, potassium hydrogen phthalate volumetric standard, potassium dichromate volumetric standard, sodium carbonate volumetric standard, refractive index standard 1.4941 at 20, 25 and 30 deg c, groundnut oil, sesame oil, castor oil, cottonseed oil, mineral oil, argemone oil, piperine standard, lead chromate, brilliant cresyl blue ( cas no 81029 05 2 ) , carmoisine / chromotrope fb ( cas no 3567 69 9 ) , erythrosin b ( cas no 16423 68 0 ) , fast green fcf ( cas no 2353 45 9 ) , indigo carmine ( cas no 860 22 0 ) , ponceau 4r ( cas no 2611 82 7 ) , sunset yellow fcf ( cas no 2783 94 0 ) , tartrazine ( cas no 1934 21 0 ) , vitamin c ( cas no 50 81 7 ) , butylated hydroxyanisole ( bha ) ( cas no 25013 16 5 ) , butylated hydroxytoluene ( bht ) ( cas no 128 37 0 ) , dodecyl gallate ( cas no 1166 52 5 ) , propyl gallate ( cas no 121 79 9 ) , octylgallate ( cas no 1034 01 1 ) , ascorbyl palmitate ( cas no 137 66 6 ) , sodium ascorbate ( cas no 134 03 2 ) , tertiary butylhydroquinone, ( tbhq ) ( cas no 1948 33 0 ) , benzoic acid ( cas no 65 85 0 ) , sorbic acid ( cas no 110 44 1 ) , caffeine ( cas no 58 08 2 ) , curcumin ( cas no 58 08 2 ) , coumarins ( cas no 58 08 2 ) , acesulfame potassium ( cas no 55589 62 3 ) , aspartame ( cas no 22839 47 0 ) , dextrose ( cas no 50 99 7 ) , isomalt ( cas no 64519 82 0 ) , isomaltulose ( cas no 13718 94 0 ) , lactose ( cas no 63 42 3 ) , maltodextrin ( cas no 9050 36 6 ) , mannitol ( cas no 69 65 8 ) , neotame ( cas no 165450 17 9 ) , saccharin sodium ( cas no 128 44 9 ) , sucralose ( cas no 56038 13 2 ) , arsenic ( cas no 7440 38 2 ) , sodium, cadmium ( cas no 7440 43 9 ) , pottasium, copper ( cas no 7440 50 8 ) , iron ( cas no 7782 61 8 ) , lead ( cas no 10099 74 8 ) , mercury ( cas no 7783 34 8 ) , nickel ( cas no 7440 02 0 ) , zinc ( cas no 7440 66 6 ) , c18:1 9t ( carbon number c18:1 trans ) , tt c18:2 ( carbon number c18:2 trans ) , 9c, 12t c18:2 ( carbon number c18:2 trans ) , 9t, 12c c18:2 ( carbon number c18:2 trans ) , 9t, 12c, 15t c18:3 ( carbon number c18:3 trans ) , 9c, 12t, 15t c18:3 ( carbon number c18:3 trans ) , 9c, 12c, 15t c18:3 ( carbon number c18:3 trans ) , 9c, 12t, 15c c18:3 ( carbon number c18:3 trans ) , 9t, 12c, 15c c18:3 ( carbon number c18:3 trans ) , butyric acid, caproic acid, capric acid, myristic acid, pentadecanoic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, linolelaidic acid, ? linolenic acid, a linolenic acid, arachidic acid, cis 11 eicosenoic acid, cis 11, 14 eicosadienoic acid, cis 8, 11, 14 eicosatrienoic acid, cis 11, 14, 17 eicosatrienoic acid, cis 5, 8, 11, 14, 17 eicosapentaenoic, cis 13, 16 docosadienoic acid, cis 4, 7, 10, 13, 16, 19 docosahexaenoic acid, sodium benzoate ( standard ) , methyl paraben, docosahexaenoic acid, galactose, eicosa pentaenoic acid methyl ester, triglycerides mixtures ( lipid standrds ) , octadecodfenoic acid, octadecemoic acid, lead ( pb ) , copper ( cu ) , manganese ( mn ) , chromate ( cr ) , nitrite ( no2 ) , iron ( fe ) , chloride ( cl ) , fluoride ( f ) , cyanide ( cn ) , sulfide ( s 2 ) , sulfat ( so4 2 ) , nitrate ( no3 ) , alkalinity, agar powder, brilliant green lactose bile broth, barrit reagent a, barrit reagent b, emb agar, lauryl sulphate tryptose broth, mr indicator, mr vp broth, macconkey broth ( single strength ) , macconkey broth ( double strength ) , gram staining kit, salt m broth, baired parker agar, egg yolk tellurite emulsion, selenite f broth, deoxycholate citrate agar, aspargine proline broth, milk agar, hiureus coagulase test kit, oxidase test kit, triple sugar iron agar slant, peptone water, alkaline peptone water, buffer peptone water, plate count agar, n. broth, lysine decarboxylase broth, chromogenic coliform agar, soyabean casein digest medium, slanetz and bartley medium, bile aesculine azide agar, xylose lysine deoxycholate agar, urea agar, urea solution, simmons citrate agar, hugh leifsons medium, nutrient gelatine, glucose salt teepol broth, chloramphanicol glucose yeast extract agar, andrade peptone water, tryptone broth, arginine dihydrolase broth, l ornithine decarboxylase broth, malonate broth, differential reinforced clostridia broth base, nitrate broth, anaerogas pack, anaero indicator tablet, steam indicator tape, biological indicator spore strips, dextrose disc for carbohydrate fermentation, lactose disc for carbohydrate fermentation, sucrose disc for carbohydrate fermentation, mannitol disc for carbohydrate fermentation, salicin disc for carbohydrate fermentation, dulcitol disc for carbohydrate fermentation, alluminium dish with lid 75 mm x 20 mm, automyser spray, beaker 100 ml, beaker 1000 ml, beaker 150 ml, beaker 250 ml, beaker 50 ml, beaker 500 ml, brush for buterometer tube, brush for measuring cylinder, brush for pipette, brush for test tube, burette screw type 10 ml, burette screw type 50 ml, burette stand plastic 2.5 ft., buretter clamp double, buterometer rack for 12 buterometers ( 2 x 6 positions ) , buterometer tube cork ( lock stopper ) , buterometer tube isi mark, boiling stone, capillary tube ( 1.0 1.1mm od x .66 .70mm id ) , cellulose extraction thimbles ( 25mm internal diameter x 80 mm external length ) , chromatography paper 1 chr ( 46cm x 57 cm ) , clevenger appartus ( oil heavier than water ) screw type, clevenger appartus ( oil lighter than water ) screw type, conical flask 100 ml with stopper b 24, conical flask 150 ml with stopper b 24, conical flask 250 ml, conical flask 5 ltr, cotton roll, dean & stark appartus set, disposable mask, draining tray, dropping bottle plastic 60 ml, evaporating glass basin 3" dia. borosilicate glass, flat bottom with spout, evaporating glass basin 4" dia. borosilicate glass, flat bottom with spout, filter paper membrane 0.2µm, filter paper no. 4 90 mm, filter paper no. 42 12.5 cm, filter paper pvdf 0.2 um x 13 mm, filter paper pvdf 0.45 um x 13 mm, filter paper pvdf 0.45 um x 47 mm, glass rod 10 , glass rod 12 , glass rod 6 , gooch crusible g 1 50 ml, gooch crusible g 4 50 ml, iodine flask 250 ml with stoper ( std joint b 24 ) , micropipette 100 to1000µl, micropipette 1000 to10000µl, micropipette tip for 1 ml to 10 ml, moisture bottle with stopper 40 ml, moisture bottle with stopper 5 gm, mojonnier flask, multiple adaptor b 24 / 24 / 24, pipette volumetric ( bulb ) 10.75 ml, pipette volumetric ( bulb ) 25 ml, pipette bulb silicon 25 ml, pipette graduated 1 ml, pipette graduated 10 ml, pipette graduated 2 ml, pipette graduated 5 ml, powerful magnate, pure white knitting wool for dye determination, reagent bottle with screw ( amber ) cap bottle cap 100 ml, reagent bottle 2 ltr ( trasperent ) , reagent bottle with screw ( amber ) cap bottle cap 500 ml, reagent bottle with screw ( transperent ) cap bottle cap 100 ml, reagent bottle with screw ( transperent ) cap bottle cap 500 ml, reagent bottle with yellow bottle ( amber ) bottle cap 500 ml, round flat bottom flask 250 mm b 24, rubber cork number 3 for mojonnier flask, s.s. dish with lid 75 mm x 20 mm, silica crusible 25 ml ( without lid ) , silica crusible 50 ml ( without lid ) , silicon tube ( i. d. 6 mm x o.d. 10 mm ) , wall thickness 2 mm, soxhlet extraction set b 24 std joint cap 100 ml, soxhlet extraction set b 24 std joint cap 60 ml, soxhlet extractor b 24 std joint, spatula s.s. 10 , spatula s.s. 6 , splash head b 24 standard joint, sterile membrane filter ( 0.45µm ) , surgical rubber gloves 7½", syringe filter holder s.s., syringe glass 5 ml, test tube with rim ( 15 x 125 mm ) , test tube with stopper 20 ml graduated, thermometer alcohol filled ( 0° c to 50° c ) 0.05° c graduation with nabl calibration certificate, thermometer alcohol filled ( 0° c to 50° c ) 0.1° c graduation with nabl calibration certificate, tissue paper roll, tlc silica gel 60 f254 ( alluminium sheets 20 cm x 20 cm ) , volumetric flask 100 110 ml with stopper, volumetric flask 100 ml with stopper, volumetric flask 1000 ml with stopper, volumetric flask 250 ml with stopper, volumetric flask 50 ml with stopper, volumetric flask 500 ml with stopper, wash bottle plastic 500 ml, white tiles 6"x 6", wire gauze s.s. 6 x 6...

Health And Family Welfare Department - Gujarat

32099200 supply of hospital consumable and disposable items disposable needle 18g x 1" (needle protector should be easily removable and well fitted hub to syringe),disposable needle 20g x 1" (needle protector should be easily removable and well fitted hub to syringe),disposable needle 21g x 1" (needle protector should be easily removable and well fitted hub to syringe),disposable needle 22g x 1" (needle protector should be easily removable and well fitted hub to syringe),disposable needle 23g x 1" (needle protector should be easily removable and well fitted hub to syringe),disposable needle 24g *x 1"(needle protector should be easily removable and well fitted hub to syringe),disposable needle 26g x 0.5" (needle protector should be easily removable and well fitted hub to syringe),disposable syringe 10 ml without needle ( non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile),disposable syringe 2 ml without needle ( non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile),disposable syringe 2 ml with 23g needle ( non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile),disposable syringe 20 ml without needle ( non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile),disposable syringe 5 ml without needle ( non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile),disposable syringe 5 ml with 23g needle ( non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile),disposable syringe 50 ml without needle ( non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile),insulin syringe 1ml (u 40) 31g (sterile, non pyrogenic),heparinised syringe 2ml (sterile, non pyrogenic),scalp vein infusin set 20g (sterile, non pyrogenic),scalp vein infusin set 21g (sterile, non pyrogenic),scalp vein infusin set 22g (sterile, non pyrogenic),scalp vein infusin set 23g (sterile, non pyrogenic),infusion set with needle (sterile, non pyrogenic),infusion set without needle (sterile, non pyrogenic),micro infusion set (non pyrogenic, non toxic, sterile),blood administration set (non pyrogenic, non toxic, sterile),i.v. catheter 16g radiopaq(non pyrogenic, non toxic, sterile),indwelling i v cannula 18g with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port,indwelling i v cannula 20g with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port,indwelling i v cannula 22g with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port,indwelling i v cannula 24g with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port,indwelling i v cannula 26g without injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port,3 way stop cock with extension tube 10 cm (non pyrogenic, non toxic, sterile, latex free, leakage proof),3 way stop cock with extension tube 100 cm (non pyrogenic, non toxic, sterile, latex free, leakage proof),3 way stop cock (non pyrogenic, non toxic, sterile, latex free, leakage proof compatible with all type of extension tubes),clinical thermometer (mercury),digital infrared thermometer for clinical use (any make) 1) measures the body temperature by determining the infrared reflected from the front radiation (no contact). 2)measuring range of the infrared temperature (body) from 32 to 42.5, • resolution 0.1, • high accuracy+/ 0.2 3)indication of measured value in °c or °f 4)limit value for the adjustable alarm as programmable 5)memory to store (expandable memory desirable) 6)easy to use, robust 7)automatic switch off 8)display backlight glow 9)waterproof lens easy to clean and disinfect 10)batteries: which are replaceable/chargeable 11)high degree of health and safety note: industrial infrared thermometer will not be accepted and minor deviation may be accepted only after sample evaluation / demonstration,cotton crepe bandage size: 10cm x 4 mtr,cotton crepe bandage size: 15 cm x4 mtr,elastic cotton crepe bandage size: 10cm x 1 mtr,disposable mask 3 ply with nose clip and tie,n95 mask,disposable surgeons cap,disposable bouffant cap,tourniquet belt/band with clip and welchrow size: 2.5 cm * 45 cm,i.v.flow regulator extension set (non pyrogenc, sterile),infant feeding tube size: 5fr. (radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile),infant feeding tube size: 6fr (radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile),infant feeding tube size: 8fr (radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile),infant feeding tube size: 10fr (radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile),transparent plastic measuring container with measure volume mark & handle size: 1000 ml,transparent plastic measuring container with measure volume mark & handle size: 500 ml,sterile needle free connector signle,sterile surgical non latex gloves (powder free) size: 6.5 cuff thickness: = 0.15 mm, palm thickness: = 0.19 mm, finger thickness: = 0.19 mm disposable pair in impermeable sterile packing, 100% electronically tested, , sterilized by gamma radiation, passed viral penetration test using phi x174 bacteriophage as per astm f 1671,sterile surgical non latex gloves (powder free) size: 7 cuff thickness: = 0.15 mm, palm thickness: = 0.19 mm, finger thickness: = 0.19 mm disposable pair in impermeable sterile packing, 100% electronically tested, , sterilized by gamma radiation, passed viral penetration test using phi x174 bacteriophage as per astm f 1671,sterile surgical latex gloves (powdered) size: 6 cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto.,sterile surgical latex gloves (powdered) size: 6.5 cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto.,sterile surgical latex gloves (powdered) size: 7 cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto.,sterile surgical latex gloves (powdered) size: 7.5 cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto.,sterile surgical latex gloves (powdered) size: 8 cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto.,non sterile powdered latex surgical gloves , size: 6.5,non sterile powdered latex surgical gloves, size: 7,non sterile powdered latex surgical gloves, size: 7.5,sterile powdered latex surgical gloves, size: 6,,sterile powdered latex surgical gloves, size: 6.5,sterile powdered latex surgical gloves, size: 7,sterile powdered latex surgical gloves, size: 7.5,non sterile latex medical examination rubber gloves, size : small, medium, large (non sterile rubber gloves, powdered smooth, single use only, excellent flexibility and strength, optimum fit & superior wet / dry grip, easier wearing, extra comfort & safety),plastic examination gloves,adhesive cottone tape roll size: 7.5 cm x 9 mtr.,surgical adhesive paper tape roll size: 1" x9.14 mtr ( optimum adhesion, non allergic to skin),surgical adhesive paper tape roll size: 2" x9.14 mtr ( optimum adhesion, non allergic to skin),surgical adhesive paper tape roll size: 3" x9.14 mtr ( optimum adhesion, non allergic to skin),water proof plaster bandage size:70 mm x 19 mm,absorbant gauze cloth size: 90 cm x 20 mtr preferable with isi grade / i.p.,absorbant cotton roll, 500 gm net,sterile gauze swab (mop) size: 25 cm x 25 cm x 8 ply (1 pack x 05 pcs) (with x ray thread),sterile / non sterile gauze swab size: 5 cm x 5 cm x 12 ply (1 pack x 100 pcs) (with x ray thread),surgical blade/knife size: no.11 (carbon steel sterilized by gamma radiation. i.s.i),surgical blade/knife size: no.15 (carbon steel sterilized by gamma radiation. i.s.i),surgical blade/knife size: no.20 (carbon steel sterilized by gamma radiation. i.s.i),stainless steel surgical suture needle half circle triagular 12g,stainless steel surgical suture needle half circle triagular 14g,stainless steel surgical suture needle half circle triagular 16g,non sterile plastic urine container with red cap, size: 30 ml,sterile plastic urine container with white cap, size: 45 ml,plastic urine container sterile(green top) (60ml),vacuette 3.5 ml with gel , yellow cap,vacuette k2 edta 2 ml , purple cap,vacuette k2 edta 4 ml, purple cap,vacuette edta k2 3.0ml (13x75mm) lavender top,vacuette edta 4.0ml (13x75mm) dark lavender top,vacuette needle 22g. (22gx1") (0.7mmx25mm),vacuette plus sodium citrate pt 1.80ml 9:1 (13x75mm),surgical cautery machine pad (disposable split return electrode),cautery pencil tip cleaner,karman cannula 6 fr. (non toxic, non pyrogenic, dispsable),karman cannula 8 fr. (non toxic, non pyrogenic, dispsable),mucus extractor (non toxic, non pyrogenic, disposable without bacterial barrier filter,anti embolism stockings, thigh length size : all,arterial cannula with flowswitch, size: 20g*45 mm,hme with bacterial and viral filter, paediatric,hme with bacterial and viral filter, adult,heat and moisture exchange filter (sterile),catheter mount (sterile),epidural catheter 18g 10 cm (radio opaque line, sterile, non toxic, non pyrogenic, latex free),contineuos epidural anaesthesia set, size: 18g *3.25" with filter (epidural set including lor syringe, filter, catheter & needle radio opaque, sterile, 3 lateral eye & 3 closer eye),double lumen central venous catheter kit, size: 7fr 16 cm (radiopaque polyurethane indwelling catheter with intergrated suture wing + nitinol guidewire j tip on one end straight tip on other end + introducer needle + vessel dilator + 5 ml syringe+ scalpel + catheter holter + extension line clamp + injection cap),ecg electrode,endotracheal tube cuffed 2 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 2.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 3 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 3.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 4 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 4.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 5.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 6 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 6.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 7 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 7.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 8 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube cuffed 8.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube plain 2 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube plain 2.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube plain 3 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube plain 3.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube plain 4 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube plain 4.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube plain 5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,endotracheal tube plain 5.5 mm material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque,high concentration oxygen mask with rebreathing bag, adult,nasal oxygen cannula (adult) (with soft material long non kinkable tubing),nasal oxygen cannula (paediatric) (with soft material long non kinkable tubing),nebuliser mouth piece t kit (adult ) (tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing),nebuliser mask kit (adult) (tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing),nebuliser mask kit (paediatric) (tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing),oxygen mask with tubbing set, (adult) tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing,oxygen mask with tubbing set (paediatric) tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing,oxygen mask with t recovery kit, tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing,hypoallergenic transparent and perforated plastic surgical tape with strong adhesion, non allergic to skin size: 2.5 cm x 9.1 mtr roll,pressure monitoring line size: 100 cm (non pyrogenic, eco friendly compatible with all syringes and 3 way ),respiratory execiser with 3 ball( with high quality transparent plastic material),ryles tube 12 fg with funnel and luer connector (radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile),ryles tube 14 fg with funnel and luer connector (radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile),ryles tube 16 fg with funnel and luer connector (radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile),single lumen central venous catheter set size:16g x 15 cm (radiopaque polyurethrane indwelling catheter with ntergraed suture wing + nitinol guidewire 60 cm dual ended "j" tip straight soft tip + introducer needle+ vessel dilator+ injection caps+ 5 ml syringe),single lumen central venous catheter 20g x 8 cm((radiopaque polyurethrane indwelling catheter with ntergraed suture wing + nitinol guidewire 60 cm dual ended "j" tip straight soft tip + introducer needle+ vessel dilator+ injection caps+ 5 ml syringe+ catheter clamp),spinal needle disposable size:18g x 3.5" (latex free, non toxic, non pyrogenic, sterile),spinal needle disposable size:20g x 3.5" (latex free, non toxic, non pyrogenic, sterile),spinal needle disposable size:23g x 3.5" (latex free, non toxic, non pyrogenic, sterile),spinal needle disposable size:25g x 3.5" (latex free, non toxic, non pyrogenic, sterile),stimuplex needle, size: 21g * 4"(insulated needle),suction catheter 12fr with thumb control (latex free, non toxic, non pyrogenic, sterile, non traumatic),suction catheter 12fr.(latex free, non toxic, non pyrogenic, sterile, non traumatic),tracheostomy tube with cuff with adjustable flange, all size,tracheostomy tube without cuff with adjustable flange, all size,triple lumen central venous catheter kit, size: 5.5 fr 8 cm (guidewire,dilator,introducer needle material should be good quality),ventialtor circuit with two limb, adult (pvc & latex free; compliance of 2 to 4 ml/mbar; material should be polypropalane or polyethylene or ethylene vinyl acetate),ventilator circuit with two limb, paediatric (pvc & latex free; compliance of 2 to 4 ml/mbar; material should be polypropalane or polyethylene or ethylene vinyl acetate),bladeless optical trocal with stability sleeve size: 12 mm x 100 mm,bladeless optical trocal with stability sleeve size: 12 mm x 150 mm,under water sealed drainage system 1000 ml(chest drain bag) non toxic , non pyrogenic,closed suction system size:12fg (a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle),closed suction system, size:14fg (a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle),closed suction system, size:16fg (a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle),closed suction system, size:18fg (a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle),corrugated drain sheet (all size),double j stent (uretric stent closed end) with radiopaque material ( all size),foley catheter, 8fr 2 way(sterile, non toxic, non pyrogenic),foley catheter, 10fr 2 way(sterile, non toxic, non pyrogenic),foley catheter, 12fr 2 way (sterile, non toxic, non pyrogenic),foley catheter, 14fr 2 way(sterile, non toxic, non pyrogenic),foley catheter, 16fr. 2 way(sterile, non toxic, non pyrogenic),foley catheter, 18fr 2 way(sterile, non toxic, non pyrogenic),foley catheter, 20fr 2 way(sterile, non toxic, non pyrogenic),foley catheter, 22fr 2 way(sterile, non toxic, non pyrogenic),foley catheter, 18fr 3 way(sterile, non toxic, non pyrogenic),foley catheter, 20fr 3 way(sterile, non toxic, non pyrogenic),foley catheter, 22fr 3 way(sterile, non toxic, non pyrogenic),silicon foley catheter, 14fr 2 way (sterile, non toxic, non pyrogenic),silicon foley catheter, 16fr 2 way (sterile, non toxic, non pyrogenic),disposable two part trocar needle (initial punture needle) size: 18g 15 cm,disposable two part trocar needle (initial punture needle) size: 18g 20 cm,percutaneous malecot nephrostomy catheter, size: 10f 30 cm (radiopaque ),percutaneous malecot nephrostomy catheter, size: 12f 30 cm (radiopaque ),percutaneous malecot nephrostomy catheter, size: 14f 30 cm (radiopaque ),nephrostomy drainage catheter open end, size: 22f 40 cm,nephrostomy drainage catheter open end, size: 24f 40 cm,nephrostomy drainage catheter open end, size: 28f 40 cm,pcn dilator set size: 8fr to 16 fr,(teflon),plain polythene drape size : 150 x140cm,poly propylene mesh size: 10 x 15 cm (ce cert. or fda approved),poly propylene mesh size:15 x 15 cm (ce cert. or fda approved),poly propylene mesh size: 30 x 30 cm (ce cert. or fda approved),stainless steel guidewire "j" tip 0.038" x 80 cm,ptfe guidewire "j" tip 0.035" x 150 cm,ptfe guidewire "s" tip 0.018" x 150 cm,ptfe guidewire "s" tip 0.025" x 150 cm,ptfe guidewire "s" tip 0.035" x 150 cm,hydrophilic guidewire "s " tip 0.025" x 150 cm,hydrophilic guidewire"s" tip 0.018" x 150 cm,hydrophilic guidewire "s" tip 0.035" x 150 cm,skin stapler 35w,sterile camera cover, size: 18.5 cm * 2 mtr.,surgical skin marker pen with scale,thoracis draiange catheter, size: 24fg (radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch ),thoracis draiange catheter, size: 28fg (radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch ),thoracis draiange catheter, size: 32fg (radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch ),tur irrigation set (sterile, non toxic, non pyrogenic, latex free),urethral cahteter (r 90) (sterile, non toxic, non pyrogenic, latex free),uretric (ureteral) catheter open end, size: 5fr 70cm,uretric (ureteral) catheter open end, size: 3fr 70cm,uretric (ureteral) catheter open end, size: 4fr 70cm,pigtail uretric (ureteral) catheter open end, size: 5 fr. 70 cm,urine collection bag with measured volume meter with tubbing size: 150 ml ( sterile, tubing should be non kinkable) ( non toxic, non pyrogenic, sterile),urine collection bag 2000 ml with tie ( non toxic, non pyrogenic, sterile),yankauer suction set with tube and suction handle,measured volume fluid administration set size: 150 ml ( latex free burette set),sterile transparent surgical dressing, size: 10 mc * 12 cm...

Health And Family Welfare Department - Gujarat

31669167 bids are invited for syringe filter ptfe , pre slit red ptfe white silicon septa for lc msms , micro pipette tips , micro pipette tip box , storage vials with screw cap , flat bottom glass insert forlc msms and gc msms , big mouth glass insert for lc msms and gc msms total quantity : 1202...

Gujarat Cancer And Research Institute - Gujarat

31304249 re tender for rate contract for laboratory glassware plasticware goods part 1 for the year 2022 2023 and 2023 24 20°c pcr mini cooler, 20°c pcr mini cooler with gel filled cover,22mm x 22mm square cover slips,24mm x 50mm rectangular cover slips,24mm x 60mm rectangular cover slips,3 way rack,4 way flipper rack,4 way microtube rack,alluminium container,aspirator bottle,aspirator bottle,auto pipettes (bluedispensing bottom),auto pipettes (grey dispensing bottom),auto pipettes (yellow dispensing bottom),auto pipettes (yellow dispensing bottom),autopipette 5 50µl,beaker glass,beaker glass,beaker glass,beaker glass,beaker glass,beaker glass,beaker glass,beaker glass,beaker measuring with handle,beaker measuring with handle,beaker plastic,beaker plastic,beaker plastic,beaker plastic,beaker plastic,beaker plastic,biopsy cassetts (plastic) with s.s. lid,carboy,carboy with stopcock,centrifuge tube,centrifuge tube,centrifuge tube,centrifuge tube,centrifuge tube box,centrifuge tube box ,cotton swab,couplin jar,couplin jar glass,cryo cube box,cryo rack 50 places,cryobox,cryobox – 100,cryovial with cryo coders (different colors),cylinder plastic,cylinder plastic,cylinder plastic,cylinder plastic,cylinder plastic,cylinder plastic,cylindre plastic,cyro gloves,disposable blade high profile (818),disposable blade low profile (819),disposable syringe filters,disposable tips,disposable tips,disposable tips,disposable tips,disposable tips,disposable tips,dropper pipette glass with rubber tit,dropper pipette glass with rubber tit,dropper rubber,embedding ring (pink),embedding ring (white),embedding ring (yellow),filter tips,filter tips,filter tips,filter tips,fine filter paper,fine filter tips 1250ul,fine filter tips 1250ul,flask conical glass,flask conical glass,flask conical glass,flask conical glass,flask conical glass,flask conical glass,float rack,float rack,freezing vial container with cover,frosted micro slide,funnel,funnel,funnel glass,funnel glass,funnel glass,gel comb,gel loading tips,glass marking pencil,glass rod,glucose test strip,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,micro cuvettes hb,ice bucket,immersion oil dispensing bottle, long neck,indicator tape for steam autoclave,lab absorbent paper roll roll,magnetic retriever,magnetic stirrer,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,micro centrifuge container,micro centrifuge tube,micro centrifuge tube,micro centrifuge tube,micro centrifuge tube,micro centrifuge tube,micro pipette,micro pipette,micro pipette,micro pipette,micro pipette,micro pipette,micro pipette,micro pipette tip box,micro pipette tip box,micro pipette tip box,micro pipette tip box,micro pipette tip box.,micro pipette tips,micro pipette tips,micro pipette tips with filter,micro pipette tips with filter,micro pipette tips with filter,micro slide,micro tubes work station rack,microscope slide tray,microtube pestle with motor,mini centrifuge,mini cooler with gel filled cover,mini cooler with gel filled cover,optical plates 96 well skirted 28440,optical sealing films for the 96 well optical plates cat.36590,parafilm m,parafilm roll with dispensor / cutter,pasture pipette,pcr mini cooler,pcr rack with cover,pcr tube,pcr tube,pcr tube with caps,pcr tube with caps,petri dish glass,petri dish glass,petri dish plastic,pipette glass,pipette glass,pipette glass,pipette glass,pipette stand for micro pipette,pipette tips,plastic brushes for laboratory good cleaning,plastic disposable tube,plastic dropper,plastic wash bottle,plastic wash bottle,plastic wash bottle,platform rocker for gels,platic forceps,rack for microtube,rack for microtube,rack for microtube,rack for pcr tube,rack for revasible rack,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reversible pcr rack,reversible rack with cover,rocker,rough filter paper,sample container for stool,sample cup,sample tips,sample tranportation box,slide box,specimen container,specimen container,spilfyter lab sockers,storage vial,storage vial tube (ria vial),super deluxe,super deluxe,test tube glass,test tube glass,test tube glass,test tube glass,test tube glass,test tube glass,test tube rack,test tube rack,test tube rack,test tube stand,thermometer glass,tips for micropipette,tips for micropipettes,tissue culture flask,tissue culture flask,tissue culture flask,tissue culture petri dish plastic,tissue culture plate 12 well,tissue culture plate 24 well,tissue culture plate 4 well,tissue culture plate 6 well,tissue culture plate 96 well,sterile connecting device,universal tips,,universal tips,,urine container,vortex mixer,zippette bottle top dispenser,aluminum slide tray,digital thermometer & hygrometer with prob,finntip 5ml,gel casting tray for 130x 130mm,gel casting tray for 250 mm x 130 mm,low attachment 6 well plates, tissue culture,plus charged slides,reagent tips,slide carrier containers ( steel ),staining containers triagle ( steel ),stem cell cassettes ( stainless steel),sterile cell strainer (por size: 70 um),glass petri plates 150 mm x25 mm,glass petri plates 100 mm x15 mm,pcr tubes 0.5 ml (autoclavable ,conical bottom , with graduation polypropylene),micro centrifuge tubes 1.5 ml(autoclavble , air tight),gel comb,auto pipettes,auto pipettes,auto pipettes,2 ml microcentrifuge tubes,biobanking and cell culture cryogenic tubes,neubar’s chamber,disposable plastic tube12x75(4 5ml),fine filter paper,multipipette m4 repeater m4,stainless steel staining jar with lid,microcentrifuge tube,0.5 µl to 10 µl multichennel reference 2 (8 channels) pipette,micropipettes,micropipettes,micropipettes,micropipettes,micropipettes,micropipettes,75cm² flask,25cm² flask,cell counting slides,qubit assay tubes,sterile cell stainer (40µm),pipette with microtube opener adapter,sterile dispoasble tissue culture pipettes (serological pipette),all in one rack (stand) for multiple volume tubes (15ml,50ml, etc),cell culture chamber with cover slide (8 well),sterile cell culture insert(pc/pe) , polycarbonate membrane (pc), polyester membrane (pe),pasture pipette,rubber pipette bulb,rubber pipette bulb,rubber pipette bulb,culture tubes glass,test tube cleaning brushes with white nylon rounded tuft bristles,test tube cleaning brushes with white nylon rounded tuft bristles,test tube cleaning brushes with white nylon rounded tuft bristles,test tube holding forceps,disposible pippette,cotton swab,zippette bottle top dispenser,glass jar,glass jar,glass jar,centrifuge tube,dropping bottle,dropping bottle,ice tray,lts tips for 10 µl volume,lts tips for 250 µl volume,micro pestle,pap pen for ihc,pcr work station rack,slide rack plastic for deparaffinization,0.1 ml 4 tube & 4 cap strips,plastic slide assembly 25 places,biopsy cassetts with plastic lid,pcr blocks,pcr blocks,8 strip tubes...

Surat Municipal Corporation - Gujarat

30230971 "tender for procurement of laboratory chemicals, reagents, glasswares, plastics, etc., items." acetone, acetone ar, aluminium nitrate, aluminium oxide activated ( neutral ) , aluminium oxide activated ( acidic ) , aluminium oxide activated ( basic ) , ammonium chloride, ammonium ferrous sulphate, tetrabutylammonium hydroxide 25%, ammonium molybdate, 1 naphthol, diphenylamine, arsenic trioxide, brilliant green bile broth, lactose broth, macconkey agar, macconkey broth w neutral red, skimmed milk agar, ringer salt solution powder, nutrient broth, nutrient agar, yeast glucose chloramphenicol agar, violet red bile glucose agar w / o lactose, ammonium oxalate, iso amyl alcohol, calcium chloride fused, sodium acetate anhydrous, aniline, antimony trichloride, ascorbic acid, barium chloride, benzaldehyde, benzene, boric acid, buffer solution ( ph 4.01 ) , buffer solution ( ph 7.00 ) , buffer solution ( ph 10.01 ) , n butanol, calcium carbonate, calcium chloride dihydrated, calcium hydroxide, calcium oxide, calcium nitrate, iso octane, carbon disulphide, carbon tetrachloride, tlc silica 60 aluminum plate ( 20x20 ) ( 250 micron layer ) , chloroform, chromium trioxide, citric acid, hydrochloric acid ar, curcumin, conc. hydrochloric acid ampules n / 1, hydrochloric acid n / 10 sol, nitric acid ar, sulphanilic acid, ammonia solution 25%, cupric acetate, copper sulphate, succinic acid, cyclohexane, di chloro dimethyl silane ( dds ) , di methyl glyoxime, pera di methylamino benzaldehyde, di phenyl amine, di potassium hydrogen phosphate, di sodium hydrogen phosphate, dichloromethane, diethyl ether lr, diethyl ether, edta disodium salt, erichrome black t indicator, ethidium bromide, edta dipotassium salt, fehling b ( pottassium sodium tartrate ) , fehling a ( copper sulphate ) , ferric ammonium sulphate, ferric chloride, ammonium ferric citrate, ferrous sulphate, formaldehyde 37%, fromic acid, furfuraldehyde, glacial acetic acid, dextrose, glycerol, glycine, n hexane, hydrogen peroxide 30%, hydroxylamine hyldrochloride, iodine, iodine tri chloride, lead acetate trihydrate, magnasium chloride hexahydrate, magnasium oxide, magnasium sulphate, mercuric chloride, metaphosphoric acid, methanol, methyl isobutyl ketone, methyl orange, methyl red, methylene blue, neutral red indicator powder, nesslers reagent, ninhydrin powder, o phosphoric acid, para toluidine, ortho toluidine, p dimethyl amino benzaldehyde ( pdab ) , parafin oil ( mineral oil ) , perchloric acid 60%, petrolium ether ( 40 60 c ) , petrolium ether ( 40 60 c ) , petrolium ether ( 60 80 c ) , phenol, phosphomolybdic acid, picric acid, plaster of paris, potassium chloride, potassium ferrocyanide, potassium iodide, pottassium chloride, pottassium chromate, pottassium dichromate, pottassium dihydrogen phosphate, potassium ferricyanide, pottassium hydrogen phthalate, pottassium hydrogen phosphate ( k2hpo4 ) , pottassium hydroxide, pottassium permanganate, pottassium sodium tartrate, pottassium sulphate, pottassium thiocyanate, ph paper strip ( 6.5 to 10.0 ) , ph paper strip ( 0 to 14.0 ) , pottussium di hydrogen phosphate, tryptone soya agar, chromogenic coliform agar, agar powder, buffered pepton water, plate count agar, bacto peptone granular, pyridine, quinoline, resorcinol, p rosolic acid, silica gel, silica gel 60 200 mesh, silica gel 230 400 mesh chromatography, silver nitrate, sodium azide, sodium bicarbonate, sodium benzoate, sodium bisulphite, sodium borate, sodium carbonate anhydrous, sodium chloride, sodium deoxycholate, sodium dihydrogen o phosphate, sodium hydrosulphite, sodium hydroxide, sodium hypochlorite, sodium molybdate, sodium nitrate, sodium nitrite, sodium sulphate, sodium sulphite, sodium thiosulphate pentahydrate, tri sodium citrate, sodium tungstate, soluble starch, stannous chloride, succinic anhydride, sucrose, sulphuric acid a.r., sulphur powder, tartaric acid, thio barbituric acid ( tba ) , thymol blue indicator, trichloro acetic acid, toluene, tri fluro acetic acid ( tfa ) , uric acid, xylene, zinc acetate, zinc chloride, zinc oxide, zinc sulphate, glass syringe 10ml, syringe filter 13mm nylon 0.45µ, regernated cellulose membrane for hplc solvent 0.45µ 47mm, regernated cellulose membrane for hplc solvent 0.2µ 47mm, filter paper for hplc sample preparation 0.45µ; 47mm, whatman 41 filter paper 125mm circle, whatman 1 filter paper 125mm circle, acesulfame potassium, sacchrin 98%, ammonium purpurate, standard calcium solution 1000mg / l, standard magnasium solution 1000mg / l, potassium chloroplatinate ( k2ptcl6 ) , cobaltous chloride ( cocl3, 6h2o ) , azomethine h sodium salt ( 8 n 2 hydroxybenzylidene ) naphth 1 01 3.6 disulphonic acid, l ascorbic acid ( c6h8o6 ) , ammonium acetate, oxalic acid, isopropyl alcohol 99%, carminic acid, standard cadmium solution 1000mg / l, sulphanilamide, n 1 naphthyl ethylene diamine dihydrochloride, potassium nitrate, urea, sodium sulphite anhydrous, antimony 1000mg / l, chromotropic acid disodium, di sodium tetraborate decahydrate, devarda s alloy powder ar, mercuric iodide, aluminium potassium sulphate, mercuric thiocyanate, ferric nitrate, patton and reeder s reagent, di ammonium hydrogen phosphate, sodium fluoride, zirconium oxychloride octahydrate, silver suphate, trans 1, 2 diaminocyclohexane n, n, n, n tetracetic acid monohydrate, tisab total ionic strength buffer solution for fluoride electrode, triethanolamine, bromocresol green indicator, potassium dihydrogen orthophosphate, n, n diethyl p phenylenediamine, dioctyl sodium sulphosuccinate, ethylene glycol monobutyl ether, sodium arsenite, diethylene glycol, erichrome blue black r, sodium oxalate, fluoride standard 1000mg / l, ß sitosterol, cholesterol, rhodamine b, annatto, gram stain reagent kit, kit for adultration testing of milk ( skim milk powder ) , multi parameter water testing kit, salt testing kit, centrifuge tube conical bottom 15ml ( autoclavable ) , centrifuge tube conical bottom 50ml ( autoclavable ) , pasteur pipette 3ml, round magnetic stirring bar with pivot ring, magnetic retriver, test tube basket with cover 180x170x160mm, centrifuge tube round bottom 10ml screw cap, centrifuge tube round bottom 50ml screw cap, methanol ( hplc ) , hplc grade water, acetonitrile, stigmasterol, n hexane hplc, n heptane hplc, isopropyl alcohol ( gc ) , aspartame, sodium saccharin, sucralose, saccharin, benzoic acid, sorbic acid, acesulfame k, caffeine, tert butyl hydroquinone, riboflavin, thiamine hydrochloride, nicotinic acid, pyridoxine hydrochloride, cyanocobalamine, 37 component fame mix, beta – n – oxalyl l amino alanine boaa, o phthalaldehyde, 2 mercaptoethanol, burette 10ml capacity class a, burette 25ml capacity class a, burette 50ml capacity class a, volumetric pipette 1 ml capacity class a, volumetric pipette 2 ml capacity class a, volumetric pipette 5 ml capacity class a, volumetric pipette 10 ml capacity class a, volumetric pipette 25 ml capacity class a, volumetric flask with glass stopperd 10ml class b, volumetric flask with glass stopperd 20ml class b, volumetric flask with glass stopperd 0ml class 25 ml class b, volumetric flask with glass stopperd 50ml class b, volumetric flask with glass stopperd 100ml class b, volumetric flask with glass stopperd 250ml class b, volumetric flask with glass stopperd 500ml class b, volumetric flask with glass stopperd 1000ml class b, test tube 25x150, test tube 18 x 150, dishes, evaporating, flat bottom, with pour out, round bottom flask 500 ml, round bottom flask 1000 ml, round bottom flask 2000 ml, essential oil determination for oil heavier than water apparatus as per is 1797, essential oil determination for oil lighter than water apparatus as per is 1797, round bottom flask 250ml 24 / 29 neck, round bottom flask 500ml 24 / 29 neck, round bottom flask 1000ml 24 / 29 neck, bromine, deionised water ( < 2 tds < 5µs conductivity ) , durham s tube, columns, chromatography, plain with sintered disc, 10mm bore, columns, chromatography, plain with sintered disc, 30mm bore, funnels, plain, 60 angle, short stem, funnels, plain, 60 angle, short stem 50mm, funnels, plain, 60 angle, short stem 75mm, adapter, enlarging, interchangeable joints 24 / 29 to 19 / 26, adapter, enlarging, interchangeable joints 34 / 35 to 24 / 29, all glass filter holder 47mm, filtration assembly, tubes, culture, media, round bottom, with pp screw cap and liner 25 x 100, tubes, culture, media, flat bottom, with pp screw cap and ptfe liner 25 x 57, crucibles, without lid 69 x 45, crucible tong with bow stainless steel, 1.5 ml micro centrifuge tubes with cap, butyrometer for fat determination in milk, butyrometer for fat determination in skimmed milk, butyrometer for fat determination in cream, butyrometer for fat determination in curd, butyrometer for fat determination in butter, dropping bottle, oven gloves pair, beaker tong, karl fischer pyridine free 250ml, conductivity solution 1.41 ms / cm, total dissolved solids ( tds ) , dessicator plain, dessicator vacuum, reusable bottle top filter, buchner funnel autoclavable, filtering flask autoclavable, micro tips low retension 1 ml, micro tips low retension 0.2 ml, universal micro tip box 1 ml ( 96 place ) , universal micro tip box 0.2 ml ( 96 place ) , sample container pp / hdpe 100ml sterile, pipettor stand ( 5 per stand ) , rack for micro tu be 24 place, conical centrifuge tube rack 15ml and 50ml hold togather, flask stand, indicator tape for steam autoclave 1x 500", tough tags 1000 per pack, hand protector grip, ss lab jack 8"x8" size platform, autoclavable biohazard bags 12x24, ph electrode ±25mv resolution, refractive index calibration standard, sodium carbonate, safety glass for eye protection, nitrile gloves medium size, refence material ( sesame oil ) , refence material ( linseed oil ) , refence material ( karanja oil ) , refence material ( castor oil ) , refence material ( cottonseed oil ) , refence material ( mineral oil ) , refence material ( argemone oil ) , refence material ( termeric powder with lead chromate ) ...

Gujarat Cancer And Research Institute - Gujarat

30169343 tender document for rate contract for laboratory glassware plasticware goods for the year 2021 2022 and 2022 23 20°c pcr mini cooler, 20°c pcr mini cooler with gel filled cover, 22mm x 22mm square cover slips, 24mm x 50mm rectangular cover slips, 24mm x 60mm rectangular cover slips, 3 way rack, 4 way flipper rack, 4 way microtube rack, alluminium container, aspirator bottle, aspirator bottle, auto pipettes ( bluedispensing bottom ) , auto pipettes ( grey dispensing bottom ) , auto pipettes ( yellow dispensing bottom ) , auto pipettes ( yellow dispensing bottom ) , autopipette 5 50µl, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker measuring with handle, beaker measuring with handle, beaker plastic, beaker plastic, beaker plastic, beaker plastic, beaker plastic, beaker plastic, biopsy cassetts ( plastic ) with s.s. lid, carboy, carboy with stopcock, centrifuge tube, centrifuge tube, centrifuge tube, centrifuge tube, centrifuge tube box, centrifuge tube box , cotton swab, couplin jar, couplin jar glass, cryo cube box, cryo rack 50 places, cryobox, cryobox – 100, cryovial with cryo coders ( different colors ) , cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylindre plastic, cyro gloves, disposable blade high profile ( 818 ) , disposable blade low profile ( 819 ) , disposable syringe filters, disposable tips, disposable tips, disposable tips, disposable tips, disposable tips, disposable tips, dropper pipette glass with rubber tit, dropper pipette glass with rubber tit, dropper rubber, embedding ring ( pink ) , embedding ring ( white ) , embedding ring ( yellow ) , filter tips, filter tips, filter tips, filter tips, fine filter paper, fine filter tips 1250ul, fine filter tips 1250ul, flask conical glass, flask conical glass, flask conical glass, flask conical glass, flask conical glass, flask conical glass, float rack, float rack, freezing vial container with cover, frosted micro slide, funnel, funnel, funnel glass, funnel glass, funnel glass, gel comb, gel loading tips, glass marking pencil, glass rod, glucose test strip, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, micro cuvettes hb, ice bucket, immersion oil dispensing bottle, long neck, indicator tape for steam autoclave, lab absorbent paper roll roll, magnetic retriever, magnetic stirrer, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, micro centrifuge container, micro centrifuge tube, micro centrifuge tube, micro centrifuge tube, micro centrifuge tube, micro centrifuge tube, micro pipette, micro pipette, micro pipette, micro pipette, micro pipette, micro pipette, micro pipette, micro pipette tip box, micro pipette tip box, micro pipette tip box, micro pipette tip box, micro pipette tip box., micro pipette tips, micro pipette tips, micro pipette tips with filter, micro pipette tips with filter, micro pipette tips with filter, micro slide, micro tubes work station rack, microscope slide tray, microtube pestle with motor, mini centrifuge, mini cooler with gel filled cover, mini cooler with gel filled cover, optical plates 96 well skirted 28440, optical sealing films for the 96 well optical plates cat.36590, parafilm m, parafilm roll with dispensor / cutter, pasture pipette, pcr mini cooler, pcr rack with cover, pcr tube, pcr tube, pcr tube with caps, pcr tube with caps, petri dish glass, petri dish glass, petri dish plastic, pipette glass, pipette glass, pipette glass, pipette glass, pipette stand for micro pipette, pipette tips, plasma sodium heparin spray dry coated, plasma sodium heparin spray dry coated, plastic brushes for laboratory good cleaning, plastic disposable tube, plastic dropper, plastic wash bottle, plastic wash bottle, plastic wash bottle, platform rocker for gels, platic forceps, rack for microtube, rack for microtube, rack for microtube, rack for pcr tube, rack for revasible rack, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reversible pcr rack, reversible rack with cover, rocker, rough filter paper, sample container for stool, sample cup, sample tips, sample tranportation box, slide box, specimen container, specimen container, spilfyter lab sockers, storage vial, storage vial tube ( ria vial ) , super deluxe, super deluxe, test tube glass, test tube glass, test tube glass, test tube glass, test tube glass, test tube glass, test tube rack, test tube rack, test tube rack, test tube stand, thermometer glass, tips for micropipette, tips for micropipettes, tissue culture flask, tissue culture flask, tissue culture flask, tissue culture petri dish plastic, tissue culture plate 12 well, tissue culture plate 24 well, tissue culture plate 4 well, tissue culture plate 6 well, tissue culture plate 96 well, sterile connecting device, universal tips, , universal tips, , urine container, vortex mixer, zippette bottle top dispenser, aluminum slide tray, digital thermometer & hygrometer with prob, finntip 5ml, gel casting tray for 130x 130mm, gel casting tray for 250 mm x 130 mm, low attachment 6 well plates, tissue culture, plus charged slides, reagent tips, slide carrier containers ( steel ) , staining containers triagle ( steel ) , stem cell cassettes ( stainless steel ) , sterile cell strainer ( por size: 70 um ) , glass petri plates 150 mm x25 mm, glass petri plates 100 mm x15 mm, pcr tubes 0.5 ml ( autoclavable , conical bottom , with graduation polypropylene ) , micro centrifuge tubes 1.5 ml ( autoclavble , air tight ) , gel comb, auto pipettes, 2 ml microcentrifuge tubes, biobanking and cell culture cryogenic tubes, neubar’s chamber, disposable plastic tube12x75 ( 4 5ml ) , flash back collection needles, paed . blood collection tube edta, paed.blood collection tube plain clot activator, intravenous neddle ( scalp vein set ) , rapid serum vacuatte, sodium heparin vacuatte, lithium heparin vacuatte, fine filter paper, paed.blood collection vacuate citrate, multipipette m4 repeater m4, stainless steel staining jar with lid, microcentrifuge tube, 0.5 µl to 10 µl multichennel reference 2 ( 8 channels ) pipette, micropipettes, micropipettes, micropipettes, micropipettes, micropipettes, micropipettes, 75cm² flask, 25cm² flask, cell counting slides, qubit assay tubes, sterile cell stainer ( 40µm ) , pipette with microtube opener adapter, sterile dispoasble tissue culture pipettes ( serological pipette ) , all in one rack ( stand ) for multiple volume tubes ( 15ml, 50ml, etc ) , cell culture chamber with cover slide ( 8 well ) , sterile cell culture insert ( pc / pe ) , polycarbonate membrane ( pc ) , polyester membrane ( pe ) , pasture pipette, test tube holding forceps, rubber pipette bulb, rubber pipette bulb, rubber pipette bulb, culture tubes glass, test tube cleaning brushes with white nylon rounded tuft bristles, test tube cleaning brushes with white nylon rounded tuft bristles, test tube cleaning brushes with white nylon rounded tuft bristles, test tube holding forceps, sodium citrate 2.7 ml vacuum blood collection tube, needle with safety lock / holders, edta vaccum tubes, esr 1.6 ml vaccum blood collection tube, sodium fluoride with edta vaccum blood collection tubes, plain clot activator vacuum tubes, gel with clot activator vaccum tubes, disposible pippette, cotton swab, zippette bottle top dispenser, glass jar, glass jar, glass jar, centrifuge tube, dropping bottle, dropping bottle, ice tray, lts tips for 10 µl volume, lts tips for 250 µl volume, micro pestle, pap pen for ihc, pcr work station rack, slide rack plastic for deparaffinization, 0.1 ml 4 tube & 4 cap strips, plastic slide assembly 25 places, biopsy cassetts with plastic lid, urine container 50ml...

U N Mehta Institute Of Cardiology & Research Center - Gujarat

29447212 e tender for rate contract for supply of hospital consumable & disposable items u n mehta institute of cardiology & research centre disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle ( needle protector should be easily removable and well fitted hub to syringe ) , disposable needle with blunt tip, disposable syringe without rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe without rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe without rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe without rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe without rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe without rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe with rubber piston non leackable, resistance free marking should be proper compatible with all type of needles, extension lines and 3 ways non toxic, non pyrogenic, sterile, disposable syringe insulin sterile, non pyrogenic, disposable syringe insulin sterile, non pyrogenic, spinal needle disposable latex free, non toxic, non pyrogenic, sterile, spinal needle disposable latex free, non toxic, non pyrogenic, sterile, spinal needle disposable latex free, non toxic, non pyrogenic, sterile, spinal needle disposable latex free, non toxic, non pyrogenic, sterile, spinal needle disposable latex free, non toxic, non pyrogenic, sterile, spinal needle disposable latex free, non toxic, non pyrogenic, sterile, spinal needle disposable latex free, non toxic, non pyrogenic, sterile, spinal needle disposable latex free, non toxic, non pyrogenic, sterile, disposable syringe black leur lock, sterile, pressure line black sterile, non pyrogenic, asepto syringe with bulb sterile, non toxic, non pyrogenic, latex free, prefilled ns ( 0.9% nacl ) syringe, prefilled ns ( 0.9% nacl ) syringe, prefilled ns ( 0.9% nacl ) syringe, toomey syringe, tuohy needle, arterial cannula vascular catheter with guidewire & introducer needle, arterial cannula vascular catheter with guidewire & introducer needle, arterial cannula vascular catheter with guidewire & introducer needle, arterial cannula one lumen catheter for seldinger technique, straight guide wire, with fixation wings ( in catheter ) , with puncture needle, arterial cannula one lumen catheter for seldinger technique, straight guide wire, with fixation wings ( in catheter ) , with puncture needle, arterial cannula vascular catheter with guidewire & introducer needle, arterial cannula with flow switch, arterial catheter with bloodless system for radial and femoral artery, closed ventilation dual lumen suction catheter with t connector, closed ventilation dual lumen suction catheter with t connector, closed ventilation dual lumen suction catheter with t connector, closed ventilation dual lumen suction catheter with t connector, closed ventilation dual lumen suction catheter with t connector, closed ventilation dual lumen suction catheter with t connector, combitubes, male external catheter / condom catheter, male external catheter / condom catheter, male external catheter / condom catheter, male external catheter / condom catheter, cvp catheter double lumen kit, cvp catheter double lumen kit, cvp catheter triple lumen kit guide wire, dilator & introducer needle material should be good, cvp catheter triple lumen kit guide wire, dilator & introducer needle material should be good, cvp catheter triple lumen kit guide wire, dilator & introducer needle material should be good, cvp catheter triple lumen kit guide wire, dilator & introducer needle material should be good, cvp catheter four lumen kit ( without pa catheter infusion facility ) guide wire, dilator & introducer needle material should be good, cvp catheter double lumen kit with silver ion / antibiotic ( minocycline ) impregnated, cvp catheter double lumen kit with silver ion / antibiotic ( minocycline ) impregnated, cvp catheter triple lumen kit with sheath, heparin coated, cvp catheter triple lumen kit with sheath, heparin coated, cvp catheter triple lumen kit with silver ion / antibiotic ( minocycline ) impregnated, continuous cardiac output catheter ( cco catheter ) compatible monitor along with catheter should be provided free of cost as per requirement of the institute, continuous cardiac output catheter ( cco catheter ) with svo2 compatible monitor along with catheter should be provided free of cost as per requirement of the institute, continuous cardiac output catheter ( cco+svo2+cedv ) compatible monitor along with catheter should be provided free of cost as per requirement of the institute, continuous cardiac output monitoring catheter by arterial pressure compatible monitor along with catheter should be provided free of cost as per requirement of the institute, pulmonary artery monitoring catheter with compatible introducer sheath ( sterile ) catheter and sheath both must be of same company, pulmonary artery monitoring catheter with co monitoring, with compatible introducer sheath ( sterile ) catheter and sheath both must be of same company, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, double lumen endobroncheal tube set including endobroncheal tube, suction catheter with color coded connectors and other accessories technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, e t tube with microcuff technical features: cuff pressure: not more than 12 cm h2o, burst pressure: upto 800 cm h2o, et tube cuff pressure monitoring device, endobronchial blockers, endobronchial blockers, endobronchial blockers, epidural catheter radio opaque line, sterile, non toxic, non pyrogenic, latex free, epidural catheter radio opaque line, sterile, non toxic, non pyrogenic, latex free, epidural catheter radio opaque line, sterile, non toxic, non pyrogenic, latex free, epidural catheter radio opaque line, sterile, non toxic, non pyrogenic, latex free, epidural catheter radio opaque line, sterile, non toxic, non pyrogenic, latex free, epidural set including lor syringe, filter, catheter & needle radio opaque, sterile, 3 lateral eye & 3 closer eye, epidural set including lor syringe, filter, catheter & needle radio opaque, sterile, 3 lateral eye & 3 closer eye, epidural set including lor syringe, filter, catheter & needle radio opaque, sterile, 3 lateral eye & 3 closer eye, epidural set including lor syringe, filter, catheter & needle radio opaque, sterile, 3 lateral eye & 3 closer eye, epidural set including lor syringe, filter, catheter & needle radio opaque, sterile, 3 lateral eye & 3 closer eye, caudal epidural needles for pediatric patient for safe and accurate caudal puncture with precisely fitting stylet, caudal epidural needles for pediatric patient for safe and accurate caudal puncture with precisely fitting stylet, flatus tube, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter all silicon sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 2 way foley catheter sterile, non toxic, non pyrogenic, 3 way foley catheter, indwelling i v cannula with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port with flange for suture hole non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port with flange for suture hole non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port with flange for suture hole non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port with flange for suture hole non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port with flange for suture hole non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port with flange for suture hole non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula with injection port with flange for suture hole non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, leakage proof injection port, indwelling i v cannula without injecting port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula without injecting port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula without injecting port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula without injecting port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula without injecting port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula without injecting port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula without injecting port non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula with safety non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula with safety non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula with safety non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula with safety non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula with safety non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula with safety non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, indwelling i v cannula with safety non pyrogenic, radio opaque with bevel type needle, flexible & kink resistant catheter, colour coded sharpness for smooth skin puncture, infant feeding tube radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile, infant feeding tube radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile, infant feeding tube radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile, infant feeding tube radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile, infant feeding tube radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile, infant feeding tube radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile, infant feeding tube radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile, infant feeding tube radio opaque line, graduation from 5 40cm, latex free, non toxic, non pyrogenic, sterile, left atrial pressure monitoring catheter, left atrial pressure monitoring catheter, left atrial pressure monitoring catheter, long non kinkable arterial cannula with flange, long non kinkable arterial cannula with flange, nasal rae tube, nasal rae tube, nasal rae tube, nasal rae tube, nasal rae tube, nasojejunal tube biocompatible, radio opaque polyurethane tube, peg balloon replacement tube, peg kit which includes; peg tube, introducer needle, scalpel, silicone external fixation plate ( radiopaque ) with integrated tube clip, tube clamp, fenestrated drape, syringe, injection needle, retrieval snare, guidewire, gauze pads, scissors, hemostat, feeding adapter, lubricating jelly, etc., peritoneal dialysis catheter sterile, non toxic, non pyrogenic, latex free, peritoneal dialysis catheter sterile, non toxic, non pyrogenic, latex free, soft malleable peritoneal dialysis catheter ( pigtail catheter ) , soft malleable peritoneal dialysis catheter ( pigtail catheter ) , peritoneal dialysis set ( includes scalpel, stylet, catheter ) sterile, non toxic, non pyrogenic, latex free, peritoneal dialysis set ( includes scalpel, stylet, catheter ) sterile, non toxic, non pyrogenic, latex free, red rubber catheter, ryles tube with funnel and luer connector radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile, ryles tube with funnel and luer connector radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile, ryles tube with funnel and luer connector radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile, ryles tube with funnel and luer connector radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile, ryles tube with funnel and luer connector radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile, ryles tube with funnel and luer connector radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile, ryles tube with funnel and luer connector radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile, ryles tube with funnel and luer connector radio opaque line & tip, latex free, non toxic, non pyrogenic, sterile, suction catheter plain latex free, non toxic, non pyrogenic, sterile, non traumatic, suction catheter plain latex free, non toxic, non pyrogenic, sterile, non traumatic, suction catheter plain latex free, non toxic, non pyrogenic, sterile, non traumatic, suction catheter plain latex free, non toxic, non pyrogenic, sterile, non traumatic, suction catheter plain latex free, non toxic, non pyrogenic, sterile, non traumatic, suction catheter plain latex free, non toxic, non pyrogenic, sterile, non traumatic, suction catheter plain latex free, non toxic, non pyrogenic, sterile, non traumatic, supra pubic urinary catheter, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter, radio opaque line sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter ( right angled ) sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, thoracic drainage catheter with trocar sterile, non pyrogenic, individually double packed in peelable pouch, tracheostomy tube with cuff, with adjustable flange, tracheostomy tube without cuff, with adjustable flange, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube cuffed with stylet radio opaque blue line high volume, low pressure cuff circular cuff, no ellipsoidal cuff cuff should be inflated without herniation, curvature should match anatomical curvature latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, tracheostomy tube non cuff with stylet radio opaque line latex free, non toxic, non pyrogenic, sterile, silicone tracheostomy tube, with cuff, silicone tracheostomy tube, without cuff, tracheostomy filter, subglottic suctioning endotracheal tube technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, subglottic suctioning tracheostomy tube, subglottic suctioning tracheostomy tube, subglottic suctioning tracheostomy tube, subglottic suctioning tracheostomy tube, subglottic suctioning tracheostomy tube, subglottic suctioning tracheostomy tube, per cutaneous tracheostomy kit technical features: disposable sterilized tracheostomy tube can be introduced by needle, guidewire & dilator technique ( seldingar ) ; fixation device should be there; one artery forcep with central lumen for tricule dilatation; central lumen can allow guidewire, per cutaneous tracheostomy kit technical features: disposable sterilized tracheostomy tube can be introduced by needle, guidewire & dilator technique ( seldingar ) ; fixation device should be there; one artery forcep with central lumen for tricule dilatation; central lumen can allow guidewire, urethral catheter k 90 ( urine incontinence set ) sterile, non toxic, non pyrogenic, latex free, peripherally inserted central catheter polyurethane catheter / silicon catheter, radio opaque, catheter graduation at every centimeter, single lumen / dual lumen, integral extension with wings / detachable hub unique split cannula allows easy removal from the picc line, breakaway needle., umbilical catheter radiopaque, transparent pvc, sterile, umbilical catheter radiopaque, transparent pvc, sterile, umbilical catheter radiopaque, transparent pvc, sterile, umbilical catheter radiopaque, transparent pvc, sterile, umbilical catheter radiopaque, transparent pvc, sterile, umbilical catheter radiopaque, transparent pvc, sterile, disposable nasal airway, disposable nasal airway, disposable nasal airway, disposable nasal airway, disposable nasal airway, disposable nasal airway, disposable nasal airway, disposable nasal airway, intubating laryngeal mask airway, intubating laryngeal mask airway, intubating laryngeal mask airway, intubating laryngeal mask airway, intubating laryngeal mask airway, intubating laryngeal mask airway, intubating laryngeal mask airway, intubating laryngeal mask airway, laryngeal mask airway, laryngeal mask airway, laryngeal mask airway, laryngeal mask airway, laryngeal mask airway, laryngeal mask airway, laryngeal mask airway, laryngeal mask airway, supraglottic airway with gel, supraglottic airway with gel, supraglottic airway with gel, supraglottic airway with gel, supraglottic airway with gel, supraglottic airway with gel, supraglottic airway with gel, supraglottic airway with gel, oral plastic airways with colour coding of various sizes, oral plastic airways with colour coding of various sizes, oral plastic airways with colour coding of various sizes, oral plastic airways with colour coding of various sizes, oral plastic airways with colour coding of various sizes, oral plastic airways with colour coding of various sizes, oral plastic airways with colour coding of various sizes, oral plastic airways with colour coding of various sizes, expiration filter ( bacterial viral filter ) for ventilator circuit should have minimum 24 hrs. working efficiency, expiration filter ( bacterial viral filter ) for ventilator circuit should have minimum 24 hrs. working efficiency, expiration filter ( bacterial viral filter ) for ventilator circuit should have minimum 24 hrs. working efficiency, hme filter ( heat & moisture exchanging filter ) common features: pvc & latex free; material should be polypropalane or polyethylene or ethylene vinyl acetate; electrostatic filteration method, sterile, should have minimum 24 hrs. working efficiency technical features: sample port; resistance: 0.8 to 1.0 at 30 l / m; bacterial & viral retention: nearly 0%; compressible volume: 50 60 ml, hme filter ( heat & moisture exchanging filter ) common features: pvc & latex free; material should be polypropalane or polyethylene or ethylene vinyl acetate; electrostatic filteration method, sterile, should have minimum 24 hrs. working efficiency technical features: sample port; resistance: 0.5 to 0.8 at 30 l / m; bacterial & viral retention: nearly 0%; compressible volume: 35 ml, hme filter ( heat & moisture exchanging filter ) common features: pvc & latex free; material should be polypropalane or polyethylene or ethylene vinyl acetate; electrostatic filteration method, sterile, should have minimum 24 hrs. working efficiency technical features: sample port; resistance: 3.0 to 4.0 at 50 l / m; bacterial & viral retention: nearly 0%; compressible volume: < 10 ml, hme and breathing system filter common features: pvc and latex free, material should be polypropalane or polyethylene or ethylene vinyl acetate, electrostatic filtration method, sterile, should have minimum 24 hrs. working efficiency. technical features: sample port, resistance: 0.8 to 1.0 at 30 lit per min, bacterial and viral retention: nearly 0percent, compressible volume: 50 60 ml, hme and breathing system filter common features: pvc and latex free, material should be polypropalane or polyethylene or ethylene vinyl acetate, electrostatic filtration method, sterile, should have minimum 24 hrs. working efficiency. technical features: sample port, resistance: 0.5 to 0.8 at 30 lit per min, bacterial and viral retention: nearly 0percent, compressible volume: 25 35 ml, hme and breathing system filter common features: pvc and latex free, material should be polypropalane or polyethylene or ethylene vinyl acetate, electrostatic filtration method, sterile, should have minimum 24 hrs. working efficiency. technical features: sample port, resistance: 3.0 to 4.0 at 50 lit per min, bacterial and viral retention: nearly 0percent, compressible volume: < 10 ml, mask for oxygen therapy tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, mask for oxygen therapy tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, mask for oxygen therapy tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, oxygen mask with nebulizing chamber tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, oxygen mask with nebulizing chamber tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, oxygen mask with nebulizing chamber tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, oxygen mask with reservoir bag ( non rebreathing mask nrm ) tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, one way valve, oxygen mask with reservoir bag ( non rebreathing mask nrm ) tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, one way valve, oxygen mask with reservoir bag ( non rebreathing mask nrm ) tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, one way valve, mask for oxygen therapy with nebulizer and t piece tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, mask for oxygen therapy with nebulizer and t piece tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, mask for oxygen therapy with nebulizer and t piece tubing length should be 200 cm soft, odorless, transparent, non kinkable tubing, nasal prong with soft material long non kinkable tubing, nasal prong with soft material long non kinkable tubing, nasal prong with soft material long non kinkable tubing, nasal prong with soft material long non kinkable tubing, silicone nasal cpap prong compatible with ge ventilator niv mode, silicone nasal cpap prong compatible with ge ventilator niv mode, silicone nasal cpap prong compatible with ge ventilator niv mode, silicone nasal cpap prong compatible with ge ventilator niv mode, nasal cpap prong with various size of caps ( set ) compatible with ge ventilator niv mode, nasal cpap prong with various size of caps ( set ) compatible with ge ventilator niv mode, high flow nasal cannula for adults flexible kink free tubing, flow rate: 10 60 l / min, high flow nasal cannula for adults flexible kink free tubing, flow rate: 10 60 l / min, high flow nasal cannula for adults flexible kink free tubing, flow rate: 10 60 l / min, high flow nasal cannula for neonates / infants / children flexible kink free tubing, high flow nasal cannula for neonates / infants / children flexible kink free tubing, high flow nasal cannula for neonates / infants / children flexible kink free tubing, high flow nasal cannula for neonates / infants / children flexible kink free tubing, high flow nasal cannula for neonates / infants / children flexible kink free tubing, wisp nasal cpap mask with harness giraffe print, child friendly, bipap mask with head harness and mask ring, silicone rubber, s.s. ring preferable neonatal, bipap mask with head harness and mask ring, silicone rubber, s.s. ring preferable pediatric, bipap mask with head harness and mask ring, silicone rubber, s.s. ring preferable pediatric, bipap mask with head harness and mask ring, silicone rubber, s.s. ring preferable pediatric, bipap mask with head harness and mask ring, silicone rubber, s.s. ring preferable adult, bipap mask with head harness and mask ring, silicone rubber, s.s. ring preferable adult, bipap mask with head harness and mask ring, silicone rubber, s.s. ring preferable adult, silicone material head harness for bipap mask, head harness with velcrow for bipap mask, vented niv mask with head harness – nasal, vented niv mask with head harness – nasal, vented niv mask with head harness – face, vented niv mask with head harness – face, non vented niv mask with head harness – nasal, non vented niv mask with head harness – nasal, non vented niv mask with head harness – face, non vented niv mask with head harness – face, venturi mask set including removable adapters technical features: constant flow system which provide different fio2 from 24% to 60%, silicon resuscitator with mask neonatal, silicon resuscitator with mask pediatric, silicon resuscitator with mask pediatric, silicon resuscitator with mask pediatric, silicon resuscitator with mask pediatric, silicon resuscitator with mask adult, silicon snuggy face mask neonatal, silicon snuggy face mask pediatric, silicon snuggy face mask pediatric, silicon snuggy face mask adult, silicon snuggy face mask adult, silicon snuggy face mask adult, rebreathing bag latex free, rebreathing bag latex free, rebreathing bag latex free, rebreathing bag latex free, rebreathing bag with bleed valve green colour, latex free, test lung ( breathing bag ) silicon, test lung ( breathing bag ) silicon, test lung ( breathing bag ) silicon, test lung ( breathing bag ) silicon, test lung ( breathing bag ) silicon, t piece sterile, "t" oxygen recovery kit, filter with t piece, positive airway pressure system technical features: 1. pressure port for easy monitoring 2. gas inlet port which can be connected with o2 lines 3. ambient air inlet 4. patient inlet which can accommodate with mouthpiece or mask or ventilator circuit 5. 4x air amplifier which can work on principal of aeronautics to provide positive inspiratory & expiratory pressure therapy which can accelerate opening airways & recruting alveoli., vibratory positive expiratory pressure therapy device technical features: 1. can be used in any spatial orientation to open airways and mobilize secretions. 2. can be disassembled for easy to clean parts that can withstand autoclaving, boiling and dishwashing. 3. patients get all the benefits of vibratory pep therapy, in the home or hospital, with a convenient, easy to clean device. 4. design: works independent of orientation ( gravity ) 5. patient may inhale through device 6. can be use with mouthpiece 7. material: autoclave able and boil able 8. dial: adjust frequency with dial with numbers!, intubation bougie technical features: long, soft, flexible plastic guidewire with double duck to allow oxygenation; one soft plastic rod for intubation of various length; disposable device for difficult intubation; marking at every 10 cm; angle should be 40 c at tip, intubation bougie technical features: long, soft, flexible plastic guidewire with double duck to allow oxygenation; one soft plastic rod for intubation of various length; disposable device for difficult intubation; marking at every 10 cm; angle should be 40 c at tip, bain circuit with latex free 2 litre reservoir bag and apl valve, mapleson f jeckson rees ( j.r. ) t piece systems technical features: with latex free 0.5 ltr bag; corrugated tube length should be 0.4 mtr / 15mm diameter with apl valve on the tag of bag; angle piece with / without luer lock port with 22 mtr / 15 f connector; 2 mtr tubing for fgf, ventilator circuit with double water trap ( kit ) common features: pvc & latex free; compliance of 2 to 4 ml / mbar; material should be polypropalane or polyethylene or ethylene vinyl acetate; water trap should be leak proof; non detachable joints technical features: 2 limb & y connector without etco2 port ( expandable and / or non expandable ) ; angle piece with etco2 port; diameter: 22 mm; length: 1.8 to 2.0 mtr; hme with bacterial & viral filter: bacterial / viral retention should be 0%, electrostatic filteration method, sample port present; should have minimum 24 hrs. working efficiency; 1 catheter mount dead space < 35 ml, length around 15 cm; extension tube for humidifier, ventilator circuit with double water trap ( kit ) common features: pvc & latex free; compliance of 2 to 4 ml / mbar; material should be polypropalane or polyethylene or ethylene vinyl acetate; water trap should be leak proof; non detachable joints technical features: 2 limb & y connector without etco2 port ( expandable and / or non expandable ) ; angle piece with etco2 port; diameter: 15 mm; length: 1.8 to 2.0 mtr; hme with bacterial & viral filter: bacterial / viral retention should be 0%, electrostatic filteration method, sample port present; should have minimum 24 hrs. working efficiency; 1 catheter mount dead space < 35 ml, length around 8 cm; extension tube for humidifier, ventilator circuit with double water trap ( kit ) common features: pvc & latex free; dehp free; compliance of 2 to 4 ml / mbar; material should be polypropalane or polyethylene or ethylene vinyl acetate; water trap should be leak proof; non detachable joints technical features: 2 limb & y connector without etco2 port ( expandable and / or non expandable ) ; angle piece with etco2 port; diameter: 10 mm; length: 1.8 to 2.0 mtr; hme with bacterial & viral filter: bacterial / viral retention should be 0%, electrostatic filteration method, sample port present; should have minimum 24 hrs. working efficiency; 1 catheter mount dead space < 35 ml, length around 8 cm; extension tube for humidifier, ventilator circuit with double water trap common features: pvc & latex free; compliance of 2 to 4 ml / mbar; material should be polypropalane or polyethylene or ethylene vinyl acetate; water trap should be leak proof; non detachable joints technical features: 2 limb & y connector ( expandable and / or non expandable ) ; diameter: 22 mm, length: 1.8 to 2.0 mtr, ventilator circuit with double water trap common features: pvc & latex free; compliance of 2 to 4 ml / mbar; material should be polypropalane or polyethylene or ethylene vinyl acetate; water trap should be leak proof; non detachable joints technical features: 2 limb & y connector ( expandable and / or non expandable ) ; diameter: 15 mm; length: 1.8 to 2.0 mtr, ventilator circuit with double water trap common features: pvc & latex free; dehp free; compliance of 2 to 4 ml / mbar; material should be polypropalane or polyethylene or ethylene vinyl acetate; water trap should be leak proof; non detachable joints technical features: 2 limb & y connector ( expandable and / or non expandable ) ; diameter: 10 mm; length: 1.8 to 2.0 mtr, wired double heated humidifier ventilator circuit common features: pvc & latex free; material should be polypropalane or polyethylene or ethylene vinyl acetate technical features: humidified chamber for active humidification, diameter: 22 mm; length: 1.5 to 2.0 mtr, wired double heated humidifier ventilator circuit common features: pvc & latex free; material should be polypropalane or polyethylene or ethylene vinyl acetate technical features: humidified chamber for active humidification, diameter: 15 mm; length: 1.5 to 2.0 mtr, wired double heated humidifier ventilator circuit common features: pvc & latex free; dehp free; material should be polypropalane or polyethylene or ethylene vinyl acetate technical features: humidified chamber for active humidification, diameter: 10 mm; length: upto 60 cms, single heated ventilator circuit common features: pvc & latex free; material should be polypropalane or polyethylene or ethylene vinyl acetate technical features: humidified chamber for active humidification; diameter: 22 mm; length: 1.5 to 2.0 mtr., single heated ventilator circuit common features: pvc & latex free; material should be polypropalane or polyethylene or ethylene vinyl acetate technical features: humidified chamber for active humidification; diameter: 15 mm; length: 1.5 to 2.0 mtr., single heated ventilator circuit common features: pvc & latex free; dehp free; material should be polypropalane or polyethylene or ethylene vinyl acetate technical features: humidified chamber for active humidification; diameter: 10 mm; length: upto 60 cms, hfo circuit – 15mm ( compatible with sle 5000 system ) pvc and latex free, hfo circuit ( compatible with sle 5000 system ) pvc, latex and dehp free, respiratory circuit system no ( nitric oxide ) circuit compatible with nitric oxide delivery system ( sle inosys model ) , pvc and latex free, respiratory circuit system no ( nitric oxide ) circuit compatible with nitric oxide delivery system ( sle inosys model ) , pvc and latex free, respiratory circuit system no ( nitric oxide ) circuit compatible with nitric oxide delivery system ( sle inosys model ) , pvc, latex and dehp free, high flow oxygen therapy heated wire ventilator circuit with compatible humidifier chamber kit for airvo 2 ventilaor model, high flow oxygen therapy heated wire ventilator circuit with compatible humidifier chamber kit for airvo 2 ventilaor model, high flow oxygen therapy heated wire ventilator circuit with compatible humidifier chamber kit for airvo 2 ventilaor model, 3 way stop cock non pyrogenic, non toxic, sterile, latex free, leakage proof compatible with all type of extension tubes, 3 way stop cock with extension tube non pyrogenic, non toxic, sterile, latex free, leakage proof 2 female, 1 male leur lock with closure caps, 3 way stop cock with extension tube non pyrogenic, non toxic, sterile, latex free, leakage proof 2 female, 1 male leur lock with closure caps, 3 way stop cock with extension tube non pyrogenic, non toxic, sterile, latex free, leakage proof 2 female, 1 male leur lock with closure caps, 3 way stop cock with extension tube non pyrogenic, non toxic, sterile, latex free, leakage proof 2 female, 1 male leur lock with closure caps, 3 way stop cock with extension tube non pyrogenic, non toxic, sterile, latex free, leakage proof 2 female, 1 male leur lock with closure caps, 3 way stop cock with extension tube non pyrogenic, non toxic, sterile, latex free, leakage proof 2 female, 1 male leur lock with closure caps, 3 way stop cock with extension tube inner diameter of extension line: 1.1 mm, non pyrogenic, non toxic, sterile, latex free, leakage proof, 3 way stop cock with extension tube inner diameter of extension line: 1.1 mm, non pyrogenic, non toxic, sterile, latex free, leakage proof, needle less connector, single lumen extension tube with split septum needle less connector, double lumen extension tube with split septum needle less connector, triple lumen extension tube with split septum needle less connector, blood transfusion set with luer lock end, intravenous set with luer lock, intravenous set without luer lock, iv micro set with luer lock non pyrogenic, non toxic, sterile, gravity feed only, scalp vein set, rapid infusion set, flow regulator with luer non pyrogenic, sterile, with injection port, disposable colostomy bag latex free, odor proof, reusable colostomy bag latex free, odor proof, corrugated drainage sheet, ecg electrodes diagnostic disposable with gel good conductivity, good skin tolerance ( non reactive to skin if kept more than 48 hrs. ) , good adhesive material proper attachment to ecg cable, ecg electrodes diagnostic disposable with gel good conductivity, good skin tolerance ( non reactive to skin if kept more than 48 hrs. ) , good adhesive material proper attachment to ecg cable, ecg electrodes diagnostic disposable with gel good conductivity, good skin tolerance ( non reactive to skin if kept more than 48 hrs. ) , good adhesive material proper attachment to ecg cable, pressure monitoring line non pyrogenic, eco friendly compatible with all syringes and 3 way, pressure monitoring line non pyrogenic, eco friendly compatible with all syringes and 3 way, pressure monitoring line non pyrogenic, eco friendly compatible with all syringes and 3 way, pressure monitoring line non pyrogenic, eco friendly compatible with all syringes and 3 way, pressure monitoring line non pyrogenic, eco friendly compatible with all syringes and 3 way, pressure monitoring line non pyrogenic, eco friendly compatible with all syringes and 3 way, sample line for measurement of anaesthesia gases transparent pvc material, 1.2 mtr to 1.5 mtr length, should have male luer fittings at both the ends for use with airway adapter, pressure monitoring kit ( with complimentary cable as and when required ) technical features: two disposable pressure transducer; one iv set; flush device 3 to 5 ml per hour ( flush control valve user friendly ) ; pressure tubing of male to female connector; 120 to 150 cm ( two ) ; 6 three way stop cock; non pyrogenic material; sterile; non kinkable aspirating device from i.v. to pressure monitoring kit; conductivity of pins should be gold plated, pressure monitoring kit ( with complimentary cable as and when required ) technical features: single disposable pressure transducer; one iv set; flush device 3 to 5 ml per hour ( flush control valve user friendly ) ; pressure tubing of male to female connector; 120 to 150 cm ( two ) ; 3 three way stop cock; non pyrogenic material; sterile; non kinkable aspirating device from i.v. to pressure monitoring kit; conductivity of pins should be gold plated, pressure transducer dome with cable sterile, non pyrogenic should be compatible with above pressure monitoring kit sr. no. 34 & 35, siliconized head ring ( heel cups type ) , siliconized head ring ( heel cups type ) , siliconized head ring ( heel cups type ) , siliconized head ring ( horseshoe type ) , siliconized head ring ( horseshoe type ) , siliconized head ring ( horseshoe type ) , siliconized head ring ( whole head base ) , siliconized head ring ( whole head base ) , siliconized head ring ( whole head base ) , siliconized shoulder pack ( dome positioner ) , siliconized shoulder pack ( dome positioner ) , siliconized shoulder pack ( dome positioner ) , sterile laproscopic camera sleeve, sterile transthoracic echo probe sleeve, close wound suction consist of a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle, close wound suction consist of a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle, close wound suction consist of a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle, close wound suction consist of a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle, close wound suction consist of a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle, close wound suction consist of a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle, close wound suction consist of a. bellow unit, b. connecting tube, c. cross perforated drain for high vaccum wound drainage system, d. curved needle, three chamber thoracic drainage system, under water sealed drainage system ( chest drain bag ) , under water sealed sterile disposable plastic bottle, under water sealed sterile disposable plastic bottle, under water sealed sterile disposable plastic bottle, under water sealed sterile disposable plastic bottle ( with base ) , under water sealed sterile disposable plastic bottle ( with base ) , under water sealed sterile disposable plastic bottle ( with base ) , urine bag non toxic, non pyrogenic, sterile, urine bag non toxic, non pyrogenic, sterile, urine collecting bag with measure volume chamber & 150cm tubing sterile, tubing should be non kinkable, urine collecting bag with measure volume chamber & 150cm tubing sterile, tubing should be non kinkable, volumetric set ( non pvc ) with luer, volumetric set ( non pvc ) with luer, enternal feeding bag with long tubing, disposable umbilical cord clamp, gas a, calibration gas for use with calibrator 540 for terumo heart lung machine online abg system, gas b, calibration gas for use with calibrator 540 for terumo heart lung machine online abg system, shunt sensor for use with cdi system ( heparin treated ) for terumo heart lung machine online abg system, 1 / 2" disposable h / s cuvettes for use with cdi system ( include 1 / 2" connectors & 1 / 2" with 6" extension tube ) for terumo heart lung machine online abg system, 1 / 4" disposable h / s cuvettes for use with cdi system ( include 1 / 4" connectors & 1 / 4" with 6" extension tube ) for terumo heart lung machine online abg system, 3 / 8" disposable h / s cuvettes for use with cdi system ( include 3 / 8" connectors & 3 / 8" with 6" extension tube ) for terumo heart lung machine online abg system, s. r. sheath 0, 1, 2, 3, 4, transseptal introducer sheath: mullin type for bmv procedures radiopaque tip marker, transseptal puncture needle compatible with 8 fr adult transseptal mullin sheath, transseptal introducer sheath: mullin type for bmv procedures radiopaque tip marker, transseptal puncture needle compatible with 8 fr pediatric transseptal mullin sheath, adhesive cloth tape usp, hypoallergenic transparent and perforated plastic surgical tape with strong adhesion non allergic to skin, hypoallergenic transparent and perforated plastic surgical tape with strong adhesion non allergic to skin, hypoallergenic transparent and perforated plastic surgical tape with strong adhesion non allergic to skin, hypoallergenic transparent and perforated plastic surgical tape with strong adhesion non allergic to skin, hypoallergenic microporous tape ( paper adhesive tape ) optimum adhesion, non allergic to skin, hypoallergenic microporous tape ( paper adhesive tape ) optimum adhesion, non allergic to skin, hypoallergenic microporous tape ( paper adhesive tape ) optimum adhesion, non allergic to skin, hypoallergenic microporous tape ( paper adhesive tape ) optimum adhesion, non allergic to skin, silk like surgical tape with hypoallergenic adhesive non allergic to skin, silk like surgical tape with hypoallergenic adhesive non allergic to skin, silk like surgical tape with hypoallergenic adhesive non allergic to skin, silk like surgical tape with hypoallergenic adhesive non allergic to skin, et tube fixation adhesive tape, alcohol swab single use and foil sachets, non woven pads, saturated 70%v / v with isopropyl alcohol, absorbable haemostatic gelatin sponge sterile, non pyrogenic, absorbent gauze piece i.p. preferable with isi grade / i.p., absorbent cotton roll i.p. net weight: 400gm gross weight: 500gm, rolled bandage no. 863 1988 10, length: 5mtr., 5 cms rolls ( 2 inch ) , rolled bandage no. 863 1988 10, length: 5mtr., 10 cms rolls ( 4 inch ) , rolled bandage no. 863 1988 10, length: 5mtr., 15 cms rolls ( 6 inch ) , elastic crepe bandage, elastic crepe bandage, elastic adhesive plaster good elasticity, good adhesive material, hydrocolloid adhesive dressing, vascular haemostatic dressing, vascular haemostatic dressing, vascular haemostatic dressing, vascular haemostatic dressing, vascular haemostatic dressing, non woven adhesive sterile wound dressing non allergic to skin, non woven adhesive sterile wound dressing non allergic to skin, non woven adhesive sterile wound dressing non allergic to skin, non woven adhesive sterile wound dressing non allergic to skin, non woven adhesive sterile wound dressing non allergic to skin, non woven adhesive sterile wound dressing non allergic to skin, non woven adhesive sterile wound dressing non allergic to skin, plastic adhesive non occlusive central line dressing non allergic to skin, plastic adhesive non occlusive central line dressing non allergic to skin, plastic adhesive non occlusive central line dressing non allergic to skin, plastic adhesive non occlusive central line dressing non allergic to skin, plastic adhesive non occlusive central line dressing non allergic to skin, plastic adhesive non occlusive central line dressing with antibiotic impregnated non allergic to skin, i.v. dressing line to provide advanced i.v. and central line catheter securement, adhesive film dressing with absorbent pad, adhesive film dressing with absorbent pad, non adhesive open mesh paraffin gauze dressing, majordrape sterile incise area 15 x 35 cm, plain poly ethylene drape, povidone iodine impregnated incise antimicrobial adhesive drape, povidone iodine impregnated incise antimicrobial adhesive drape, sterile transperant screen cover, disposable cabg pack sterile ( water, blood, alcohol resistant, sms fabric of 35 gsm ) which includes; plain drape ( 160*150 cm ) 5 pcs; mayo trolley cover 1 pc; under patient sheet ( 160*250 cm ) 1 pc; triangular drape sheet ( 80*100 cm ) 2 pcs; groin drape ( 40*40 cm ) 1 pc; screen cover ( 160*250 cm ) 1 pc; adhesive towel ( w 140cm*l 150cm ) 4 pcs; main drape / cardiac drape smmms fabric of 35 gsm ( 150*250cm, incise area 20*40cm holes at 5 points ) 1 pc; diathermy bag 4 pcs; surgical gown smmms fabric of 35 gsm, reinforced in front ( from chest to above knee ) & on sleeves ( from wrist to above elbow ) , two napkin in each gown 5 pcs; hole towel 2 pcs, disposable cabg pack sterile with povidone iodine impregnated incise antimicrobial adhesive drape ( water, blood, alcohol resistant, sms fabric of 35 gsm ) which includes; plain drape ( 160*150 cm ) 5 pcs; mayo trolley cover 1 pc; under patient sheet ( 160*250 cm ) 1 pc; triangular drape sheet ( 80*100 cm ) 2 pcs; groin drape ( 40*40 cm ) 1 pc; screen cover ( 160*250 cm ) 1 pc; adhesive towel ( w 140cm*l 150cm ) 4 pcs; main drape / cardiac drape smmms fabric of 35 gsm with iodised ioban ( 150*250cm, incise area 20*40cm holes at 5 points ) 1 pc; diathermy bag 4 pcs; surgical gown smmms fabric of 35 gsm, reinforced in front ( from chest to above knee ) & on sleeves ( from wrist to above elbow ) , two napkin with each gown 5 pcs; hole towel 2 pcs, non cabg kit sterile ( water, blood, alcohol resistant, sms fabric of 35 gsm ) which includes; plain drape ( 160*150 cm ) 5 pcs; mayo trolley cover 1 pc; under patient sheet ( 160*250 cm ) 1 pc; screen cover ( 160*250 cm ) 1 pc; adhesive towel ( w 140cm*l 150cm ) 4 pcs; main drape / cardiac drape smmms fabric of 35 gsm ( 150*250cm, incise area 20*40cm holes at 4 points ) 1 pc; diathermy bag 4 pcs; surgical gown smmms fabric of 35 gsm, reinforced in front ( from chest to above knee ) & on sleeves ( from wrist to above elbow ) , two napkin in each gown 5 pcs; hole towel 2 pcs, non cabg kit sterile with povidone iodine impregnated incise antimicrobial adhesive drape ( water, blood, alcohol resistant, sms fabric of 35 gsm ) which includes; plain drape ( 160*150 cm ) 5 pcs; mayo trolley cover 1 pc; under patient sheet ( 160*250 cm ) 1 pc; screen cover ( 160*250 cm ) 1 pc; adhesive towel ( w 140cm*l 150cm ) 4 pcs; main drape / cardiac drape smmms fabric of 35 gsm with iodised ioban ( 150*250cm, incise area 20*40cm holes at 4 points ) 1 pc; diathermy bag 4 pcs; surgical gown smmms fabric of 35 gsm, reinforced in front ( from chest to above knee ) & on sleeves ( from wrist to above elbow ) , two napkin in each gown 5 pcs; hole towel 2 pcs, peadiatric cardiac drape kit sterile ( water, blood, alcohol resistant, sms fabric of 35 gsm ) which includes; plain drape ( 160*150 cm ) 5 pcs; mayo trolley cover 1 pc; under patient sheet ( 160*250 cm ) 1 pc; screen cover ( 160*250 cm ) 1 pc; adhesive towel ( w 140cm*l 150cm ) 4 pcs; main drape / cardiac drape smmms fabric of 35 gsm ( 150*250cm, incise area 15*35cm ) 1 pc; diathermy bag 4 pcs; surgical gown smmms fabric of 35 gsm, reinforced in front ( from chest to above knee ) & on sleeves ( from wrist to above elbow ) , two napkin in each gown 5 pcs; hole towel 1 pc, peadiatric cardiac drape kit sterile with povidone iodine impregnated incise antimicrobial adhesive drape ( water, blood, alcohol resistant, sms fabric of 35 gsm ) which includes; plain drape ( 160*150 cm ) 5 pcs; mayo trolley cover 1 pc; under patient sheet ( 160*250 cm ) 1 pc; screen cover ( 160*250 cm ) 1 pc; adhesive towel ( w 140cm*l 150cm ) 4 pcs; main drape / cardiac drape smmms fabric of 35 gsm with iodised ioban ( 150*250cm, incise area 15*35cm ) 1 pc; diathermy bag 4 pcs; surgical gown smmms fabric of 35 gsm, reinforced in front ( from chest to above knee ) & on sleeves ( from wrist to above elbow ) , two napkin in each gown 5 pcs; hole towel 1 pc, cathlab gown including 2 hand towels sms fabric of 50 gsm with high absorbency, eto sterile., angiography / angioplasty drape sms fabric of 40 45 gsm with high absorbent reinforcement, with femoral fenestrations, eto sterile., radial absorbent drape with adhesive tapes sms fabric of 40 45 gsm with high absorbent reinforcement, eto sterile., angiography / angioplasty kit sterile ( sms fabric with high absorbency ) which includes; cathlab gown ( 50 gsm ) 2 pcs., hand towel 4 pcs., femoral absorbent drape of 40 45 gsm with adhesive tapes ( 160x350cm ) – 1 pc. wrapping sheet ( 80x100cm ) – 1 pc. main trolley drape reinforced ( 160x250cm ) – 1 pc., angiography / angioplasty kit sterile ( sms fabric with high absorbency ) which includes; cathlab gown ( 50 gsm ) 2 pcs., hand towel 4 pcs., radial absorbent drape of 40 45 gsm with adhesive tapes ( 80x100cm ) – 1 pc. wrapping sheet ( 80x100cm ) – 1 pc. main trolley drape reinforced ( 160x250cm ) – 1 pc., disposable thin plastic apron back side open with strip, above head wearing, surgical disposable plastic apron ( with full sleeves ) water resistant thickness: 60 gsm, surgical disposable plastic gown ( with full sleeves ) water resistant thickness: 60 gsm, reinforced surgical gown ( water, blood & alcohol resistant ) smmms fabric of 50 gsm, antistatic, sterile, reinforced in front ( from chest to above knee ) & on sleeves ( from wrist to above elbow ) , reinforced surgical gown ( water, blood & alcohol resistant ) smmms fabric of 35 gsm, antistatic, sterile, reinforced in front ( from chest to above knee ) & on sleeves ( from wrist to above elbow ) , aami level 3 surgical gown, aami level 4 surgical gown, polypropylene plastic gown, 35 gsm non woven disposable gown, 50 gsm non woven disposable gown, hiv drape kit sterile ( water, blood, alcohol resistant ) consists of surgical gown smmms fabric of 35 gsm, reinforced in front & on sleeves 1 pc; fabric shoe cover above ankle to cover the whole foot 1 pair; goggle 1 pc, shoe cover disposable with clips compatible to shoe cover dispenser complimentary shoe cover dispenser should be provided as and when required by the institute specifications for shoe cover dispenser: specify body material of the dispenser, specify weight of the dispenser, specify dimension of the dispenser, specify capacity of the dispenser, specify manufacturing standards of the dispenser, specify shoe cover material, specify automatic / manual, disposable non woven shoe cover, surgeons cap disposable, surgeons face mask disposable ( 2 ply ) with nose pin, with ear loop, surgeons face mask disposable ( 2 ply ) with nose pin, with tie on type, surgeons face mask disposable ( 3 ply ) with nose pin, with ear loop, surgeons face mask disposable ( 3 ply ) with nose pin, with tie on type, cloth mask with ear loop, surgeons face mask disposable with eye shield, n95 mask, n99 mask, sterile surgical latex gloves ( powdered ) cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) cuff thickness: > 0.20 mm, palm thickness: > 0.20 mm, finger thickness: > 0.20 mm disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powdered ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powder free ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powder free ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powder free ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powder free ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powder free ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powder free ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., sterile surgical latex gloves ( powder free ) disposable pair in impermeable sterile packing, hypoallergic latex, 100% electronically tested, sterilized by gamma radiation / eto., non sterile reusable surgical latex gloves ( powdered ) , non sterile reusable surgical latex gloves ( powdered ) , non sterile reusable surgical latex gloves ( powdered ) , non sterile reusable surgical latex gloves ( powdered ) , non sterile reusable surgical latex gloves ( powdered ) , non sterile reusable surgical latex gloves ( powdered ) , non sterile reusable surgical latex gloves ( powdered ) , lead gloves ( sterile ) for high radiation exposure procedures, surgical latex free sterile gloves, surgical latex free sterile gloves, surgical latex free sterile gloves, surgical latex free sterile gloves, surgical latex free sterile gloves, surgical latex free sterile gloves, surgical latex free sterile gloves, surgical latex free gloves sterile ( powder free ) , surgical latex free gloves sterile ( powder free ) , surgical latex free gloves sterile ( powder free ) , surgical latex free gloves sterile ( powder free ) , surgical latex free gloves sterile ( powder free ) , surgical latex free gloves sterile ( powder free ) , surgical latex free gloves sterile ( powder free ) , high quality latex sterile gloves for cardiology ( powdered ) , high quality latex sterile gloves for cardiology ( powdered ) , high quality latex sterile gloves for cardiology ( powdered ) , high quality latex sterile gloves for cardiology ( powdered ) , high quality latex sterile gloves for cardiology ( powdered ) , high quality latex sterile gloves for cardiology ( powdered ) , high quality latex sterile gloves for cardiology ( powdered ) , high quality latex sterile gloves for cardiology ( 100 percent powder free ) 100 percent powder free documentary proof to be submitted. for highly allergic person., high quality latex sterile gloves for cardiology ( 100 percent powder free ) 100 percent powder free documentary proof to be submitted. for highly allergic person., high quality latex sterile gloves for cardiology ( 100 percent powder free ) 100 percent powder free documentary proof to be submitted. for highly allergic person., high quality latex sterile gloves for cardiology ( 100 percent powder free ) 100 percent powder free documentary proof to be submitted. for highly allergic person., high quality latex sterile gloves for cardiology ( 100 percent powder free ) 100 percent powder free documentary proof to be submitted. for highly allergic person., high quality latex sterile gloves for cardiology ( 100 percent powder free ) 100 percent powder free documentary proof to be submitted. for highly allergic person., high quality latex sterile gloves for cardiology ( 100 percent powder free ) 100 percent powder free documentary proof to be submitted. for highly allergic person., disposable latex medical examination gloves non sterile rubber gloves, powdered smooth, single use only, excellent flexibility and strength, optimum fit & superior wet / dry grip, easier wearing, extra comfort & safety, disposable latex medical examination gloves non sterile rubber gloves, powdered smooth, single use only, excellent flexibility and strength, optimum fit & superior wet / dry grip, easier wearing, extra comfort & safety, disposable latex medical examination gloves non sterile rubber gloves, powdered smooth, single use only, excellent flexibility and strength, optimum fit & superior wet / dry grip, easier wearing, extra comfort & safety, disposable plastic gloves ( non sterile ) , disposable plastic gloves ( sterile ) , non sterile nitrile gloves ( powder free ) , non sterile nitrile gloves ( powder free ) , varicose vein stocking above the knee compression level class i, varicose vein stocking above the knee compression level class ii, varicose vein stocking above the knee compression level class iii, varicose vein stocking blow the knee compression level class i, varicose vein stocking blow the knee compression level class ii, varicose vein stocking blow the knee compression level class iii, chest binder with sternal pad technical features for chest binder: 1. one size fit to all 2. dry tex foam cloth: length 45 inches 3. breadth: 8 inches 4. elastic: length: 22.5 inches 5. breadth: 8 inches 6. velcro: soft 23.5 inches 7. velcro: hard 13 inches 8. velcro: width 2 inches technical features for sternal pad: 1. thickness of sternal pad: 2 inches 2. splint: one splint used made of plastic 3. foam and eva sheet pad: length 10 inches 4. breadth: 4 inches 5. colour of product: skin, cervical collar, splint bandage, knee brace, arm sling support, philadelphia collar with trach hole, ankle binder, ankle traction belt, suspensory scrotal support, abdominal binder, skin barrier for stoma, splint bandage, disposable fore arm sleeve, flow incentive inspiratory spirometer for adult patient technical features: 1. transparent plastic material 2. adjustable incentive marker, flow incentive inspiratory spirometer for pediatric patient technical features: 1. transparent plastic material 2. adjustable incentive marker 3. oxygen port at the back of device 4. universal one way valve to ensure all patient inhale, rather than exhale in to unit, volume based spirometer for adults technical features: 1. transparent plastic material 2. adjustable incentive marker 3. oxygen port at the back of device 4. visual scale to help monitor that breathing exercise is carried out correctly 5. universal one way valve to ensure all patient inhale, rather than exhale in to unit, phototherapy black glasses for pediatric patient should be block uva & uvb rays, should be made up of cloth with elastic strap, disposable under pads super absorbent, adjustable adhesive tape, impermeable and anti slip, uni sex, bag with zipper for transportation of dead body of patient material: ld plastic, bag with zipper for transportation of dead body of patient material: non woven laminated, ppe kit ( sterile ) which includes 1. 60 gsm non woven hot melt breathable pe film laminated coverall suit with tape over seam 1 no. 2. shoe cover upto knee length 1 pair 3. three ply mask 1 no. 4. nitrile gloves 1 pair 5. n95 mask ( swasa / venus / 3m ) 1 no. 6. goggles 1 no. water, blood resistant, coverall shall have in built hood cap, zipper of the coverall shall be covered with a flap to avoid accumulation of microbes soft elastic to be fitted around front of hood, wrists & ankles, ppe kit ( sterile ) which includes 1. 90 gsm non woven hot melt breathable pe film laminated coverall suit with tape over seam 1 no. 2. shoe cover upto knee length 1 pair 3. three ply mask 1 no. 4. nitrile gloves 1 pair 5. n95 mask ( swasa / venus / 3m ) 1 no. 6. goggles 1 no. water, blood resistant, coverall shall have in built hood cap, zipper of the coverall shall be covered with a flap to avoid accumulation of microbes soft elastic to be fitted around front of hood, wrists & ankles, 60 gsm non woven hot melt breathable pe film laminated coverall suit with tape over seam + shoe cover upto knee length ( sterile ) water, blood resistant, coverall shall have in built hood cap, zipper of the coverall shall be covered with a flap to avoid accumulation of microbes soft elastic to be fitted around front of hood, wrists & ankles, 90 gsm non woven hot melt breathable pe film laminated coverall suit with tape over seam + shoe cover upto knee length ( sterile ) water, blood resistant, coverall shall have in built hood cap, zipper of the coverall shall be covered with a flap to avoid accumulation of microbes soft elastic to be fitted around front of hood, wrists & ankles, shoe cover upto knee length ( sterile ) 90 gsm non woven hot melt breathable pe film laminated, shoe cover upto knee length ( sterile ) 60 gsm non woven hot melt breathable pe film laminated, gown with wrap around upto ankle length with neck collar ( sterile ) 90 gsm non woven hot melt breathable pe film laminated, gown with wrap around upto ankle length with neck collar ( sterile ) 60 gsm non woven hot melt breathable pe film laminated, goggles • with transparent glasses, zero power, well fitting, covered from all sides with elastic band / or adjustable holder. • good seal with the skin of the face with complete leak proof seal. • flexible frame to easily fit all face contours without too much pressure. • covers the eyes and surrounding areas and accommodates for prescription glasses. • fog and scratch resistant. • adjustable band to secure firmly so as not to become loose during clinical activity. • indirect venting to reduce fogging. • may be re usable ( provided appropriate arrangements for decontamination are in place ) or disposable. • can be worn over the spectacles, face shield • it should be without scratches and brand new. • made of clear thick plastic and provides good visibility to both the wearer and the patient • adjustable band to attach firmly around the head and fit snuggly against the forehead • fog resistant ( preferable ) • completely covers the sides and length of the face, helmet type face shield with thick glass ( reusable ) , digital infrared thermometer for clinical use ( any make ) • measures the body temperature by determining the infrared reflected from the front radiation ( no contact ) . • measuring range of the infrared temperature ( body ) from 32 to 42.5, • resolution 0.1, • high accuracy+ / 0.2 • indication of measured value in °c or °f • limit value for the adjustable alarm as programmable • memory to store ( expandable memory desirable ) • easy to use, robust • automatic switch off • display backlight glow • waterproof lens easy to clean and disinfect • batteries: which are replaceable / chargeable • high degree of health and safety note: industrial infrared thermometer will not be accepted and minor deviation may be accepted only after sample evaluation / demonstration, diaper velcro fastener, diaper velcro fastener, diaper velcro fastener, diaper velcro fastener, diaper velcro fastener, diaper velcro fastener, diaper pant pant style, diaper pant pant style, diaper pant pant style, diaper pant pant style, diaper pant pant style, diaper pant pant style, adult diaper velcro fastener, adult diaper velcro fastener, adult diaper velcro fastener, adult diaper velcro fastener, adult diaper velcro fastener, aortic punch, act tube compatible machine should be provided free of cost as per requirement of the institute, act tube compatible machine should be provided free of cost as per requirement of the institute, bull dog clamp disposable ( vascular clip ) jaw length: 17 mm, jaw opening: 12 mm, bull dog clamp disposable ( vascular clip ) jaw length: 16 mm, jaw opening: 12 mm, micro vessel bull dog clamp disposable ( for mics ) clipping power: 120 gf, vessel diameter: 2 to 4 mm, opthalmic micro surgical knife crescent tip, opthalmic micro surgical knife kerotome, opthalmic micro surgical knife lance tip, surgical knife lance tip, umbilical cotton tape, coronary shunt ( opaque ) sterile, coronary shunt ( transparent ) sterile, carotid surgery shunt ( 3 limbs ) , carotid surgery shunt ( 2 limbs ) , embolectomy catheter, embolectomy catheter, embolectomy catheter, embolectomy catheter, embolectomy catheter, graft thrombectomy catheter, graft thrombectomy catheter, venous thrombectomy catheter, venous thrombectomy catheter, endo aortic clamp with cardioplegia delivery system and vent ( endoluminal clamp ) , haemostatic clip ( complimentary clip applicator should be provided whenever required ) , haemostatic clip ( complimentary clip applicator should be provided whenever required ) , haemostatic clip ( complimentary clip applicator should be provided whenever required ) , haemostatic clip ( complimentary clip applicator should be provided whenever required ) , haemostatic clip ( complimentary clip applicator should be provided whenever required ) , surgical cautery machine pad dual disposable, compatible with conmed, valley lab & erbe cautery machine, surgical cautery machine pad dual disposable, compatible with conmed, valley lab & erbe cautery machine, surgical cautery machine pad dual disposable, compatible with conmed, valley lab & erbe cautery machine, surgical cautery pencil with button ( power control ) disposable, compatible with conmed, valley lab & erbe cautery machine, surgical cautery pencil foot control without button, 9.3 mm diameter disposable, compatible with conmed, valley lab & erbe cautery machine, surgical cautery pencil tip compatible with all type of cautery pencil, surgical cautery pencil tip compatible with all type of cautery pencil, cautery tip cleaner, capacitive coupling patient return electrode, capacitive coupling dual cord patient return electrode, surgical adhesive ( sealant ) , surgical adhesive ( sealant ) , surgical adhesive ( sealant ) , surgical adhesive ( sealant ) , surgical glue ( for dry surface ) , surgical glue ( for dry surface ) , surgical glue ( for dry surface ) , surgical glue ( for oozy surface wet surface ) , surgical glue ( for oozy surface wet surface ) , surgical glue ( for oozy surface wet surface ) , biological glue, biological glue, biological glue, surgical glue ( powder form ) , powder ( talc ) for intrapleural administration, powder ( talc ) for intrapleural administration, snugger disposable ( color coaded ) sterile, non pyrogenic, snugger disposable ( color coaded ) sterile, non pyrogenic, soft tissue retractor for mics, soft tissue retractor for mics, soft tissue retractor for mics, surgical marker pen, surgical scrub brush / sponge with nail cleaner chlorhexidine digluconate 4%, dry surgical brush / sponge with nail cleaner, surgically folded gauze ( non sterile ) , surgically folded gauze ( non sterile ) , surgically folded gauze with radio opaque line ( non sterile ) , surgically folded gauze with radio opaque line ( non sterile ) , surgically folded gauze ( sterile ) , surgically folded gauze ( sterile ) , surgically folded gauze with radio opaque line ( sterile ) , surgically folded gauze with radio opaque line ( sterile ) , surgically folded gauze with radio opaque line ( sterile ) , surgically folded gauze with radio opaque line ( non sterile ) , suture organizer, negative pressure wound therapy system as and when required, bidder has to provide machine required for negative pressure wound therapy free of cost to the institute during the therapy. bidder can take back the machine after therapy is over., negative pressure wound therapy system as and when required, bidder has to provide machine required for negative pressure wound therapy free of cost to the institute during the therapy. bidder can take back the machine after therapy is over., negative pressure wound therapy system as and when required, bidder has to provide machine required for negative pressure wound therapy free of cost to the institute during the therapy. bidder can take back the machine after therapy is over., canister with gel, canister with gel, canister with gel, vein holder, vessel loops sterile, non pyrogenic, vascular conduit solution to protect graft endothelium, ecmo circuit for maquet machine [ oxygenator for ecmo highly plasma resistant extend life supporting ( minimum / week ) ( with temperature probe and stand whenever required ) ] , ecmo circuit for maquet machine [ oxygenator for ecmo highly plasma resistant extend life supporting ( minimum / week ) ( with temperature probe and stand whenever required ) ] , ecmo circuit for maquet machine [ oxygenator for ecmo highly plasma resistant extend life supporting ( minimum / week ) ( with temperature probe and stand whenever required ) ] , harmonic ace plus shears 36 cm, harmonic ace plus shears 36 cm with advanced hemostasis, harmonic ace plus shears 23 cm with advanced hemostasis, harmonic handpiece for connecting probe, 220v, enseal g2 tissue sealer straight jaw 35 cm with articulation, enseal g2 tissue sealer straight jaw 35 cm without articulation, enseal g2 tissue sealer straight jaw 25 cm without articulation, harmonic blue handpiece, harmonic ace plus shears 23 cm, harmonic focus plus shears 17 cm, harmonic focus plus shears 9 cm, harmonic synergy blade, harmonic synergy hook, a v blood tubing set pvc tubing, injection site: large finger guard, drip chamber: should be available in various diameter, clamps: large or small, priming vol: 100 150 ml, should be available in broad range, compatible with a variety of different machines, soft, flexible as well as strong artery & venous chambers, a v fistula needle cannula: extra thin wall with back eye, wing: turnable, a v fistula needle cannula: extra thin wall with back eye, wing: turnable, hemodialysis triple lumen catheter kit introducer needle: 17 / 18 g x 7 cm, guidewire: 0.032" / 0.035" / 0.038" x 80 / 70 cm, st. / curved triple lumen catheter, two injection sealing caps, 11 no. scalpel, dressing material, vessel dilator: sizes according to catheter size, hemodialysis triple lumen catheter kit introducer needle: 17 / 18 g x 7 cm, guidewire: 0.032" / 0.035" / 0.038" x 80 / 70 cm, st. / curved triple lumen catheter, two injection sealing caps, 11 no. scalpel, dressing material, vessel dilator: sizes according to catheter size, transducer protector antibacterial hydrophobic air filter with female luer lock / male luer lock, protective hydrophobic barrier, dialysis fluid filter for machine of fresenius 4008 s, dialysis fluid filter for bbraun hemodialysis machine, dialyzer priming vol: 70 150 ml, maximum tmp: 500 mm / hg, surface area: 1.3 m2, good biocompatibility and hemocompatibility, dialyzer priming vol: 70 150 ml, maximum tmp: 500 mm / hg, surface area: 1.3 m2, good biocompatibility and hemocompatibility, inline steam sterilization, dialyzer priming vol: 70 150 ml, maximum tmp: 500 mm / hg, surface area: 1.5 m2, good biocompatibility and hemocompatibility, dialyzer priming vol: 70 150 ml, maximum tmp: 500 mm / hg, surface area: 1.5 m2, good biocompatibility and hemocompatibility, inline steam sterilization, dialyzer priming vol: 70 150 ml, maximum tmp: 500 mm / hg, surface area: 1.8 m2, good biocompatibility and hemocompatibility, dialyzer priming vol: 70 150 ml, maximum tmp: 500 mm / hg, surface area: 1.8 m2, good biocompatibility and hemocompatibility, inline steam sterilization, dialyzer priming vol: 25 50 ml, maximum tmp: 500 mm / hg, surface area: 0.6 m2, good biocompatibility and hemocompatibility, dialyzer priming vol: 25 50 ml, maximum tmp: 500 mm / hg, surface area: 0.6 m2, good biocompatibility and hemocompatibility, inline steam sterilization, dialyzer priming vol: 25 50 ml, maximum tmp: 500 mm / hg, surface area: 0.8 m2, good biocompatibility and hemocompatibility, dialyzer priming vol: 25 50 ml, maximum tmp: 500 mm / hg, surface area: 0.8 m2, good biocompatibility and hemocompatibility, inline steam sterilization, concentrated haemodialysis solution part a compositions for each 1000 ml: sodium chloride 165 gm, calcium chloride 8.10 gm, potassium chloride 6.0 gm, magnesium chloride 3.70gm, acetic acid ( glacial ) 9.46 gm, concentrated haemodialysis solution part a compositions for each 1000 ml: sodium chloride 210 gm, calcium chloride 8.0 gm, potassium chloride 5.2 gm, magnesium chloride 2.7 gm, acetic acid ( glacial ) 6.3 gm, concentrated haemodialysis solution part a compositions for each 1000 ml: sodium chloride 216 gm, calcium chloride 8.0 gm, potassium chloride 5.2 gm, magnesium chloride 2.7 gm, acetic acid ( glacial ) 6.3 gm, concentrated haemodialysis solution with dextrose part a compositions for each 1000 ml: sodium chloride 210.68 gm, calcium chloride 9.0 gm, potassium chloride 5.22 gm, magnesium chloride 3.56 gm, acetic acid ( glacial ) 6.31 gm, dextrose monohydrate 38.5 gm, potassium free solution part a compositions: sodium chloride 165 gm, calcium chloride 8.10 gm, magnesium chloride 3.70 gm, acetic acid ( glacial ) 9.46 gm, potassium free solution part a compositions: sodium chloride 210 gm, calcium chloride 8.0 gm, magnesium chloride 2.7 gm, acetic acid ( glacial ) 6.3 gm, haemodialysis solution part b compositions: sodium bicarbonate 660 gm, sodium chloride 235 gm, to be dissolved in purified water to make 10 litre solution, haemodialysis solution part b ( bibag 4008 ) , haemodialysis solution part b ( bibag 4008 ) , dry bicarbonate haemodialysis solution part b for bbraun machine, dry bicarbonate haemodialysis solution part b for bbraun machine, dry bicarbonate haemodialysis solution part b for bbraun machine, citro sterile solution to be used for heat disinfection of haemodialysis machine, tricarb c 50 solution to be used for disinfection of harmodialysis machine, 5 micron cartridge for water filter, disposable, extracorporeal circuit consist of a an 69 hf hollow fiber ( an69 acrylonitrile and sodium methallyl sulfonate copolymer ) intended for use in the following veno venous therapies: scuf, cvvh, cvvhd, cvvhd. the set is permanently connected to a blood line, blood return line, a dialysate inlet line and an effluent outlet line. the fluid pathways of the set are sterile and nonpyrogenic. the set is to be used for patients who have acute renal failure, fluid overload, or both., disposable, extracorporeal circuit consist of a an 69 hf hollow fiber ( an69 acrylonitrile and sodium methallyl sulfonate copolymer ) intended for use in the following veno venous therapies: scuf, cvvh, cvvhd, cvvhdf. the set is permanently connected to a blood line, bloodreturn line, a dialysate inlet line and an effluent outlet line. the fluid pathways of the set are sterile and nonpyrogenic. set is to be used for patients ( minimal patient weight 11 kg ) who have acute renal failure, fluid overload or both., disposable, extracorporeal circuit consist of a paes ( polyarylethersulfone ) hollow fiber hemofilter / dialyzer intended for use in the following veno venous therapies: scuf, cvvh, cvvhd, cvvhdf. the set is permanently connected to a blood line, blood return line, a dialysate inlet line and aneffluent outlet line. the fluid pathways of the set are sterile and non pyrogenic . the set is to be used for patients ( minimal patient weight >8 kg ) who have acute renal failure, fluid overload, or both., electrolytes, bicarbonates solution for haemofiltration, haemodiafiltration & continuous haemodialysis. it should be potassium free, before reconstitution each ml contains calcium chloride, 2h2o, 5.145 gm, magnesium chloride , 6h20, 2.033 gm, lactic acid 5.4 gm, sodiumchloride 6.45 gm, sodium hydrozen carbonate 3.090 gm, water for injection., blood purification set consists of acrylonitrile and sodium methallyl sulfonate copolymer + polyethyleneimine ( surface treatment agent ) +heparin grafted. this set should be intended for use in the following veno venous therapies: scuf; cvvh; cvvhd; cvvhdf. the set should able to permanently connected to a blood line, blood return line, a dialysate inlet line and an effluent outlet line. the fluid pathways of the set should be sterile and non pyrogenic., haemofiltration solution for regional citrate anticoagulation in continuous renal replacement therapy. solution contains sodium chloride 5.03g / lit, sodium citrate 5.29g / lit., bicarbonate buffered solution for haemodialysis, haemofiltration & haemodifilteration. solution is used as replacement solution and as dialysis solution for treatment of acute kidney injury during continuous renal replacement therapy ( crrt ) . solution is calcium free, lactate free , before reconstitution contains magnesium chloride 3.05g / lit, sodium chloride 7.01g / lit, sodium hydrogen carbonate 2.12g / lit, potassium chloride 0.314g / lit, disodium phosphate dehydrate 0.187g / lit., disposable, extracorporeal circuit set consists of a polypropylene hollow fiber plasmafilter and tubing lines. this filter is permanently connected to a blood access line, a blood return line and an effluent outlet line. the fluid pathways of the set are sterile and non pyrogenic. set is intended for use in therapeutic plasma exchange, removal of plasma components., arterial filter for extracorporeal circuit maximum blood flow rate: 0.7 2.5 lit / min, arterial filter for extracorporeal circuit maximum blood flow rate: upto 5 lit / min, arterial filter for extracorporeal circuit maximum blood flow rate upto 6 8 lit / min, blower / mister, cardioplegia multi lumen delivery set, cardiotomy reservoir hard shell, cell saver kit for machine of fresenius kabi, cardioplegia heat exchanger with delivery set / myocardial protective system ( with temperature probe & stand whenever required ) specifications: maximum blood flow rate: 500 1000 ml / min, priming volume: 44 60 ml, blood inlet&outlet 1 / 4", water inlet / outlet 1 / 2" connector, cardioplegia heat exchanger with delivery set / myocardial protective system ( with temperature probe & stand whenever required ) specifications: maximum blood flow rate: 250 499 ml / min, priming volume: 30 40 ml, blood inlet&outlet 1 / 4", water inlet / outlet 1 / 2" connector, cardioplegia heat exchanger without delivery set / myocardial protective system ( with temperature probe & stand whenever required ) specifications: maximum blood flow rate: 500 1000 ml / min, priming volume: 44 60 ml, blood inlet&outlet 1 / 4", water inlet / outlet 1 / 2" connector, cardioplegia heat exchanger without delivery set / myocardial protective system ( with temperature probe & stand whenever required ) specifications: maximum blood flow rate: 250 499 ml / min, priming volume: 30 40 ml, blood inlet&outlet 1 / 4", water inlet / outlet 1 / 2" connector, custom tubing pack pvc tubing made of usp class vi ethylene oxide sterilized., custom tubing pack pvc tubing made of usp class vi ethylene oxide sterilized., custom tubing pack pvc tubing made of usp class vi ethylene oxide sterilized., haemoconcentrator membrane surface area: 0.05 0.09 m², priming vol: 8 15 ml, max. tmp: 500 700 mmhg, molecular wt. cut off: 65, 000 dalton, haemoconcentrator membrane surface area: 0.2 0.5 m², priming vol: 17 35 ml, max. tmp: 500 700 mmhg, molecular wt. cut off: 65, 000 dalton, haemoconcentrator membrane surface area: 0.9 1.4 m², priming vol: 45 100 ml, max. tmp: 500 700 mmhg, molecular wt. cut off: 65, 000 dalton, pre cut tubing for extracorporial circuit, pre cut tubing for extracorporial circuit, pre cut tubing for extracorporial circuit, pre cut tubing for extracorporial circuit, pre prime filter venous line filter with connector 1 / 4" x 1 / 4", pre prime filter venous line filter with connector 3 / 8" x 1 / 2", pre prime filter venous line filter with connector 3 / 8" x 1 / 4", pre prime filter venous line filter with connector 3 / 8" x 3 / 8", sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit, sterile connector for extracorporial circuit...

Ahmedabad Municipal Corporation - Gujarat

28152403 annual rate contract for supply of laboratory chemicals, glassware’s and miscellaneous articles to the public health laboratory of ahmedabad municipal corporation, year 2020 21. 1 . additional funnel (b 24 ) 100 ml 2 . additional funnel graduated (b 24 ) 100 ml (as per instruction 35) 3 . air condenser b 24 1 mtr 4 . air condenser b 24 1.3 mtr 5 . alluminium dish with lid 2.5 cm diameter 6 . amber colour volumetric flask 100 ml 7 . asbestos plate 8 . asbestose gloves 9 . aspirator bottle plastic 10 ltr 10 . aspirator bottle plastic 5 ltr 11 . auto dispensor (b 24) 5 ml 12 . auto dispensor 10 ml 13 . automyser spray 14 . beaker 100 ml 15 . beaker 100 ml plastic 16 . beaker 1000 ml 17 . beaker 1000 ml plastic 18 . beaker 150 ml 19 . beaker 250 ml 20 . beaker 250 ml plastic 21 . beaker 50 ml 22 . beaker 500 ml 23 . beaker 500 ml plastic 24 . beaker tong 250 ml with jaws 25 . beaker tong s.s. 10 26 . beaker tong s.s. 12 27 . beaker tong s.s. 8 28 . beaker with handle 250 ml plastic 29 . beaker with handle 500 ml plastic 30 . bell jar inner diameter 7 inch x 10 inch height 31 . boss head powder coated 32 . brush for buterometer tube 33 . brush for measuring cylinder 34 . brush for pipette 35 . brush for test tube 36 . buchner flask 1000 ml 37 . buchner flask 2000 ml 38 . buchner flask 250 ml 39 . buchner flask 500 ml 40 . burette automatic 50 ml (0.1 ml div) 41 . burette screw type 10 ml 42 . burette screw type 50 ml 43 . burette stand plastic 2.5 ft. 44 . buterometer rack for 12 buterometers (2 x 6 positions) 45 . buterometer tube cork (lock stopper) 46 . buterometer tube isi mark 47 . capillary tube (1.0 1.1mm od x .66 .70mm id) 48 . cellulose extraction thimbles (25mm internal diameter x 80 mm external length) 49 . centrifuge tube glass 50 ml 50 . centrifuge tube plastic 50 ml 1 . chromatographic chamber with lid 2 . chromatography paper 1 chr (46cm x 57 cm) 3 . clamp 3 finger powder coated 4 . clevenger appartus (oil heavier than water) screw type 5 . clevenger appartus (oil lighter than water) screw type 6 . cold finger dispenser 7 . conical flask 100 ml 8 . conical flask 100 ml with stopper b 24 9 . conical flask 150 ml 10 . conical flask 150 ml with stopper b 24 11 . conical flask 250 ml 12 . conical flask 5 ltr 13 . conical flask 50 ml 14 . conical flask 500 ml b 24 15 . conical gradutate tube 1 ml 16 . conical gradutate tube 10 ml 17 . conical gradutate tube 2 ml 18 . conical gradutate tube 20 ml 19 . conical gradutate tube 50 ml 20 . cotton roll 21 . cylinder of 1 ltr (diameter of 95 mm and internal height 142 mm ) with alluminium / brass /s.s. 22 . dean & stark appartus set 23 . desicator plastic 12 24 . desicator porcelain plate 10 25 . desicator porcelain plate 12 26 . desicator porcelain plate 8 27 . disposable cap 28 . disposable mask 29 . dropping bottle plastic 120 ml 30 . dropping bottle plastic 60 ml 31 . evaporating dish porcelin 3 dia round botom with spout 32 . evaporating dish porcelin 4 dia round botom with spout 33 . evaporating glass basin 3 dia. borosilicate glass, flat bottom with spout 34 . evaporating glass basin 4 dia. borosilicate glass, flat bottom with spout 35 . filter paper no. 1 12.5 cms 36 . filter paper no. 1 18.5 cms 37 . filter paper no. 1 47 mm 38 . filter paper no. 1 46 x 57 mm 39 . filter paper no. 4 90 mm 40 . filter paper no. 42 12.5 cm 41 . filter paper pvdf 0.2 um x 13 mm 42 . filter paper pvdf 0.45 um x 13 mm 43 . filter paper pvdf 0.45 um x 47 mm 44 . filteration assembly (as per instruction 35) 45 . filteration assembly (as per instruction 35) 46 . flask tong 200 mm with jaws 47 . funnel 3 plastic 48 . funnel 4 plastic 49 . funnel glass 3 50 . funnel glass 4 1 . furnace tong 18 2 . glass bead 5 mm 3 . glass column 30 x 450 mm 4 . glass column for total polar count 5 . glass marker pen 6 . glass rod 10 7 . glass rod 12 8 . glass rod 6 9 . gooch crucibe / platinum crucibe 10 . gooch crusible g 1 50 ml 11 . gooch crusible g 4 50 ml 12 . iodine flask 250 ml with stoper (std joint b 24) 13 . measuring cylinder 10 ml 14 . measuring cylinder 100 ml 15 . measuring cylinder 100 ml class a 16 . measuring cylinder 100 ml plastic 17 . measuring cylinder 25 ml 18 . measuring cylinder 25 ml class a 19 . measuring cylinder 25 ml plastic 20 . measuring cylinder 250 ml 21 . measuring cylinder 250 ml class a 22 . measuring cylinder 250 ml plastic 23 . measuring cylinder 50 ml 24 . measuring cylinder 50 ml class a 25 . measuring cylinder 50 ml plastic 26 . measuring cylinder 500 ml 27 . measuring cylinder 500 ml class a 28 . measuring cylinder 500 ml plastic 29 . measuring cylinder with cork 1000 ml 30 . measuring cylinder with cork 50 ml 31 . measuring cylinder with cork 500 ml 32 . metaloop ss 2 33 . micro slides 75 mm x 25 mm 34 . micropipette 100 to1000µl 35 . micropipette 1000 to10000µl 36 . micropipette tip 37 . microscope cover slip 38 . moisture bottle with stopper 40 ml 39 . moisture bottle with stopper 5 gm 40 . mojonnier flask 41 . multiple adaptor b 24/24/24 42 . museum jar 22 x 25 x 12 43 . museum jar 30 x 17 x 9 44 . nitrate gloves 45 . petri dish rack plastic 46 . petri plates 4 ( 90 mm x 15mm) 47 . ph paper ( 2.0 to 10.5 ) 48 . ph paper 6.5 to 9.0 49 . pipette volumetric (bulb) 10.75 ml 50 . pipette volumetric (bulb) 25 ml 1 . pipette volumetric (bulb) 50 ml 2 . pipette bulb silicon 25 ml 3 . pipette filler 4 . pipette graduated 1 ml 5 . pipette graduated 10 ml 6 . pipette graduated 2 ml 7 . pipette graduated 5 ml 8 . pipette stand verticle 9 . powerful magnate 10 . protein glass tube 11 . reagent bottle 2 ltr (amber) 12 . reagent bottle 2 ltr (trasperent) 13 . reagent bottle with screw (amber) cap bottle cap 500 ml 14 . reagent bottle with screw (transperent) cap bottle cap 100 ml 15 . reagent bottle with screw (transperent) cap bottle cap 500 ml 16 . reagent bottle with yellow bottle (amber) bottle cap 500 ml 17 . regulatory pin for lock stopper 18 . retord ring brass 19 . retord stand 20 . round bottom flask 1000 mm b 24 21 . round bottom flask 500 mm b 24 22 . round flat bottom flask 250 mm b 24 23 . round flat bottom flask 500 mm b 24 24 . rubber cork number 3 for mojonnier flask 25 . s.s. dish with lid 200 x 75 mm 26 . saftey cap 27 . saftey goggles 28 . saftey mask 29 . separating funnel 125 ml screw type 30 . separating funnel 250 ml screw type 31 . separating funnel 500 ml screw type 32 . silica crusible 100 ml (with lid) 33 . silica crusible 25 ml (without lid) 34 . silica crusible 50 ml (without lid) 35 . silicon tube ( i. d. 6 mm x o.d. 10 mm), wall thickness 2 mm 36 . sintered glass crusibel no. 1 to 70 ml 37 . siphon tube 38 . soxhlet extraction set b 24 std joint cap 100 ml 39 . soxhlet extraction set b 24 std joint cap 60 ml 40 . soxhlet extractor b 24 std joint 41 . spatula s.s. 10 42 . spatula s.s. 6 43 . splash head b 24 standard joint 44 . splash head for sulphur dioxide estimation 45 . sterile membrane filter(o.45µm) 46 . surgical rubber gloves 7 47 . surgical rubber gloves 7½ 48 . syringe filter holder s.s. 49 . syringe glass 5 ml 50 . test tube stand metal ( 12 hole ) 1 . test tube stand metal ( 24 hole ) 2 . test tube holder 3 . test tube with rim (15 x 125 mm ) 4 . test tube with rim (15 x 150 mm) 5 . test tube with rim size 6 x 3/4 6 . test tube with stopper 20 ml (one mark) 7 . test tube with stopper 20 ml graduated 8 . test tube without rim (15 x 125 mm ) 9 . test tube without rim (18 x 150 mm ) 10 . thermometer alcohol filled ( 0° c to 100° c ) 0.05° c graduation with nabl calibration certificate 11 . thermometer alcohol filled ( 0° c to 100° c ) 0.1° c graduation with nabl calibration certificate 12 . thermometer alcohol filled ( 0° c to 50° c ) 0.05° c graduation with nabl calibration certificate 13 . thermometer alcohol filled ( 0° c to 50° c ) 0.1° c graduation with nabl calibration certificate 14 . thermometer alcohol filled ( 80° c to 20° c ) 0.1° c graduation with nabl calibration certificate 15 . thermometer alcohol filled ( 80° c to 20° c ) 1° c graduation with nabl calibration certificate 16 . thermometer mercury filled ( 0° c to 100° c ) 0.05° c graduation with nabl calibration certificate 17 . thermometer mercury filled ( 0° c to 100° c ) 0.1° c graduation with nabl calibration certificate 18 . thermometer mercury filled ( 0° c to 50° c ) 0.05° c graduation with nabl calibration certificate 19 . thermometer mercury filled ( 0° c to 50° c ) 0.1° c graduation with nabl calibration certificate 20 . thermometer mercury filled ( 30° c to 50° c ) 1° c graduation with nabl calibration certificate 21 . thermometer (mercury filled) (90.0 ° c to 370.0 ° c) graduation 2.0 ° c with nabl calibration certificate 22 . tilt measure 1 ml (b 24 std joint) 23 . tissue paper roll 24 . tlc silica gel 60 f254 (alluminium sheets 20 cm x 20 cm) 25 . tripod 26 . volatile oil seperator tube heavier than water 27 . volatile oil seperator tube lightar than water 28 . volumetric flask 100 110 ml with stopper 29 . volumetric flask 100 ml with stopper 30 . volumetric flask 100 ml with stopper class a 31 . volumetric flask 1000 ml with stopper 32 . volumetric flask 1000 ml with stopper class a 33 . volumetric flask 250 ml with stopper 34 . volumetric flask 250 ml with stopper class a 35 . volumetric flask 50 ml with stopper 36 . volumetric flask 50 ml with stopper class a 37 . volumetric flask 500 ml with stopper 38 . volumetric flask 500 ml with stopper class a 39 . wash bottle plastic 500 ml 40 . washing apron 41 . water condenser 1 ft b 24 42 . white tiles 6x 6 43 . wire gauze s.s. 6 x 6 ...

Department Of Space - Gujarat

28063030 bids are invited for pall make acrodisc syringe filters with ghp membrane, 0.45microm, 25mm (200/pkt) total quantity : 1...

Department of Agricultural Research and Education - Gujarat

27801378 rate contract for gene sequencing and related services , gene sequencing & related services , sequencing services , virom sequencing , oligo synthesis , chemicals / biochemicals 4 , chemicals / biochemicals 5 , chemicals / biochemicals 6 , glasswares 1 , glasswares 2 , glasswares 3 , glasswares 4 , glasswares 5 , glasswares 6 , plasticwares 1 , plasticwares 2 , plasticwares 3 , plasticwares 4 , plasticwares 5 , plasticwares 6 , filter papers & related items 1 , filter papers & related items 2 , filter papers & related items 3 , filter papers & related items 4 , filter papers & related items 5 , filter papers & related items 6 , membranes & syringe filter 1 , membranes & syringe filter 2 , membranes & syringe filter 3 , membranes & syringe filter 4 , membranes & syringe filter 5 , membranes & syringe filter 6 , columns and other chromotography consumables 1 , columns and other chromotography consumables 2 , columns and other chromotography consumables 3 , columns and other chromotography consumables 4 , columns and other chromotography consumables 5 , columns and other chromotography consumables 6 , field research consumables 1 , field research consumables 2 , field research consumables 3 , field research consumables 4 , field research consumables 5 , field research consumables 6 , any other lab / field consumables [pl . specify] 1 , any other lab / field consumables [pl . specify] 2 , any other lab / field consumables [pl . specify] 3 , any other lab / field consumables [pl . specify] 4 , any other lab / field consumables [pl . specify] 5...

Department of Agricultural Research and Education - Gujarat

26880140 tender for entering in to rate contract of lab consumables such as chemicals , glasswares , plasticwares , filter paper and columns etc . tender for entering in to rate contract of lab consumables such as chemicals , glasswares , plasticwares , filter paper and columns etc . , rate contract for lab consumables such as chemicals , glasswares , plasticwares , filter paper & consumables etc . , chemicals / biochemicals 1 , chemicals / biochemicals 2 , chemicals / biochemicals 3 , chemicals / biochemicals 4 , chemicals / biochemicals 5 , chemicals / biochemicals 6 , glasswares 1 , glasswares 2 , glasswares 3 , glasswares 4 , glasswares 5 , glasswares 6 , plasticwares 1 , plasticwares 2 , plasticwares 3 , plasticwares 4 , plasticwares 5 , plasticwares 6 , filter papers & related items 1 , filter papers & related items 2 , filter papers & related items 3 , filter papers & related items 4 , filter papers & related items 5 , filter papers & related items 6 , membranes & syringe filter 1 , membranes & syringe filter 2 , membranes & syringe filter 3 , membranes & syringe filter 4 , membranes & syringe filter 5 , membranes & syringe filter 6 , columns and other chromotography consumables 1 , columns and other chromotography consumables 2 , columns and other chromotography consumables 3 , columns and other chromotography consumables 4 , columns and other chromotography consumables 5 , columns and other chromotography consumables 6 , field research consumables 1 , field research consumables 2 , field research consumables 3 , field research consumables 4 , field research consumables 5 , field research consumables 6 , any other lab / field consumables [pl . specify] 1 , any other lab / field consumables [pl . specify] 2 , any other lab / field consumables [pl . specify] 3 , any other lab / field consumables [pl . specify] 4 , any other lab / field consumables [pl . specify] 5...

Gujarat Cancer And Research Institute - Gujarat

22270026 re tender for rate contract for supply of laboratory glassware and plastic ware goods for the year 2019 20 & 2020 21 101. 4 way flipper rack 102. alluminium container 103. centrifuge tube box 104. centrifuge tube box 105. couplin jar glass 106. cryovial with cryo coders ( different colors ) 107. cyro gloves 108. disposable syringe filters 109. float rack 110. freezing vial container with cover 111. funnel...

Department of Agricultural Research and Education - Gujarat

21688045 rate contract of lab consumables such as chemicals glasswares plastic wares filter paper and columns etc . , chemicals / biochemicals , glasswares , plasticwares , filter papers & related items , membranes & syringe filter , columns and other chromotography consumables , field research consumables , any other lab / field consumables [ pl . specify ] , a: , b:...

Health And Family Welfare Department - Gujarat

20605534 tender for purchase of kits , chemicals , labware , consumables items for mecrobiology department gmers , general hospital, gandhinagar 634 disposable dropper 635 disposable dropper 636 disposable dropper 637 disposable dropper 638 blotting paper sheet 639 tissue paper roll 640 filter paper disc ( whatman grade 1 ) 641 packing paper brown coloured 642 thick packing thread ( cotton ) 643 parafilm m 644 elisa reagent trough 645 syringe filter 646 syringe filter 647 cable tie 648 cable tie 649 non absorbent cotton roll 650 a4 paper 651 a5 paper => open...

Health And Family Welfare Department - Gujarat

19877924 e – tender for rate contract for supply of hospital consumable and surgical items for gujarat adani institute of medical sciences ( gaims ) , g. k. general hospital, bhuj, kachch, gujarat 46 e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque 47 e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque 48 e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque 49 e t tube cuffed technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque 50 e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque 51 e t tube plain technical features: material should be international standards, non pyrogenic, match with anatomical curvature, latex free, patient comfort for tolerance for long time ventilation, non toxic, sterile, radio opaque 52 epidural set including lor syringe, filter, catheter & needle radio opaque, sterile, 3 lateral eye & 3 closer eye 53 foley catheter sterile, non toxic, non pyrogenic 54 foley catheter sterile, non toxic, non pyrogenic 55 foley catheter sterile, non toxic, non pyrogenic 56 foley catheter sterile, non toxic, non pyrogenic => open...

Gujarat Cancer And Research Institute - Gujarat

19569087 rate contract for supply of laboratory glassware and plastic ware goods . 1 20°c pcr mini cooler 2 20°c pcr mini cooler with gel filled cover 3 22mm x 22mm square cover slips 4 24mm x 50mm rectangular cover slips 5 24mm x 60mm rectangular cover slips 6 3 way rack 7 4 way flipper rack 8 4 way microtube rack 9 alluminium container 10 aspirator bottle 11 aspirator bottle 12 auto pipettes ( bluedispensing bottom ) 13 auto pipettes ( grey dispensing bottom ) 14 auto pipettes ( yellow dispensing bottom ) 15 auto pipettes ( yellow dispensing bottom ) 16 autopipette 5 50μl 17 beaker glass 18 beaker glass 19 beaker glass 20 beaker glass 21 beaker glass 22 beaker glass 23 beaker glass 24 beaker glass 25 beaker measuring with handle 26 beaker measuring with handle 27 beaker plastic 28 beaker plastic 29 beaker plastic 30 beaker plastic 31 beaker plastic 32 beaker plastic 33 biopsy cassetts ( plastic ) with s.s. 34 carboy 35 carboy with stopcock 36 centrifuge tube 37 centrifuge tube 38 centrifuge tube 39 centrifuge tube 40 centrifuge tube box 41 centrifuge tube box 42 cotton swab 43 couplin jar 44 couplin jar glass 45 cryo cube box 46 cryobox 47 cryobox – 100 48 cryovial with cryo coders ( different colors ) 49 cylinder plastic 50 cylinder plastic 51 cylinder plastic 52 cylinder plastic 53 cylinder plastic 54 cylinder plastic 55 cylindre plastic 56 cyro gloves 57 disposable blade high profile ( 818 ) 58 disposable blade low profile ( 819 ) 59 disposable syringe filters 60 disposable tips 61 disposable tips 62 disposable tips 63 disposable tips 64 disposable tips 65 disposable tips 66 dropper pipette glass with rubber 67 dropper pipette glass with rubber 68 dropper rubber 69 embedding ring ( pink ) 70 embedding ring ( white ) 71 embedding ring ( yellow ) 72 esr stand 73 filter tips 74 filter tips 75 filter tips 76 filter tips...

Anand Agricultural University - Gujarat

17022397 supply of scientific/laboratory instruments equipment, acs, printers, furniture & fixtures, tractor & software a. gas chromatography tandem mass spectrometry system (gc ms/ms) b. data station with software system c. essential accessories online ups , mobile data station , laser printer , tower ac , led d. spares i. he gas filter (tower top) ii. oxytrap iii long life, high temperature low bleeding green septa, maximum setpoint 300 °c iv. a) auto sampler syringes 10μl b) suitable syringe for head space v. filament cartridge vi. spare ei ion source vii. a) 2 ml vials and caps with septa b) suitable vials for head space and caps with septa, with crimping tool c) caps with septa for head space vials viii. a) vespel ferrules for capillary columns of 0.25 mm id b) vespel ferrules for capillary columns of 0.32 mm id c) vespel ferrules for capillary columns of 0.53 mm id ix. a) glass liners for split injection b) glass liners for splitless injection c) glass liners for ptv injection x. oil for vacuum pump xi. capillary columns a) 30 m x 0.25mm i.d. x film 0.25 μ, phase 1701 b) 30 m x 0.25mm i.d. x film 0.25 μ, phase 5 c) 30 m x 0.32mm i.d. x film 3 μ, phase 5 (for head space) with suitable ferrules d) 30 m x 0.53mm i.d. x film 5 μ, phase 5 (for head space) with xii. mixture of minimum 200 pesticide standard, minimum 1 ppm and 1 ml with at least one year expiry date xiii. ptfe syringe filter, 0.22μ, 13mm diameter xiv. psa powder xv. c 18 powder etc....

Central University Of Gujarat - Gujarat

7890541 rate contract for supply of laboratory chemicals, glass ware, plastic ware & miscellaneous items at cug plastic ware 1. 100 mm dish 2. 60 mm dish 3. 35 mm dish 4. t 75 cm2 flask 5. t 25 cm2 flask 6. 96 well plates 7. 96 well plates (non coated) 8. 48 well plates 9. 24 well plates 10. 12 well plates 11. 6 well plates 12. 50 ml tube 13. 15 ml tube 14. 2 ml micro centrifuge tube 15. 2 ml micro centrifuge tube (amber) 16. 1.5 ml eppendorf tube 17. pcr tube 18. 10 ml serological pipettes 19. serological pipettes 25 ml 20. cryo vials 21. 1 ml pipette tips 22. 20 200 μl pipette tips 23. 2 20 μl pipette tips 24. 5 ml pipette tips 25. autoclave bags 26. biohazard bags (big black bags) 27. confocal chamber slides 28. confocal cover slip 29. cryobox (25 well) 30. cryobox (96 well) 31. pcr tube box 32. cell lifter 33. cell scraper 34. fibronectin coated well plate 35. reservoirs 36. cryoboxes 5x5, 37. cryoboxes 12x8 38. conical tubes – 15 ml 39. conical tubes – 50 ml 40. serological pipettes – 10 ml 41. t75 flask 42. t25 flasks 43. tissue culture plates 100 mm 44. tissue culture plates 60 mm 45. tissue culture plates 35 mm 46. 6 well plate 47. 12 well plate 48. 24 well plate 49. 48 well plate 50. 96 well plate non treated 51. 96 well plate black 52. microcentrifuge tube (2 and 1.5 ml) 53. ultra centrifuge tube 54. centrifuge tube (2 and 1.5 ml) 55. cuvettes for electroporation 56. cuvettes for spectrophtometer 57. pcr tube 58. micropipettes tip (0.5, 200, 1000 and 59. cryobox 60. pcr tube box 61. culture glass flask 62. plant tissues culture tube 63. filter paper 64. bacterial culture tube, glass ware 1. pasteur pipettes 2. facs tube 3. borosil bottle 500 4. borosil bottle 1000 5. glass bottles 250 ml 6. facs tubes, cell culture media and other 1. fbs 2. syringe filter (0.2 u) 3. media filter (0.2 u) 4. rpmi (without hepes) 5. rpmi (without glucose) 6. dmem f12 7. dmem (low glucose) 8. dmem (without glucose) 9. dmem (high glucose) 10. hams f 12 (high glucose) 11. huvec media (part a+part b) 12. huvec media (part a) 13. reagent pack subculture reagent for saec cells 14. calcium free media 15. mem 16. hams f 12 17. mebm media 18. himesoxl mesenchymal stem cell expansion medium, reduced serum 19. cryo vials 20. autoclavable bags 21. rpmi (without hepes buffer) 22. mem 23. fetal bovine serum (fbs), antibiotics 1. penicillin+streptomycin pentrap antibiotic solution 2. antimycotic, 1. penicillin+streptomycin pentrap antibiotic solution 2. antimycotic 1. trypsin 2. rtase 3. taq polymerase 4. poly (a) polymerase 5. taq polymerase 6. rtaase 7. pngase 8. enzymes (re, ligase polymerase, etc), general chemicals and reagent 1. hepes 2. sodium pyruvate 3. chloroform (moleculannual/repair grade) 4. isopropyl alcohol (moleculannual/repair grade) 5. ethanol 6. ethyl alcohol (moleculannual/repair grade) 7. methanol 8. tris base 9. glycine 10. ecl solution 11. fixer 12. developer 13. dmso 14. mtt dye 15. bradford reagent 16. ammonium persulfate (moleculannual/repair biology grade) 17. acrylamide 18. bis acrylamide 19. sodium chloride 20. tween 20 21. etbr 22. agarose 23. hcl 24. naoh 25. trypan blue 26. dcfda 27. n acetyl cystine 28. h2o2 29. lipopolysaccharide from e.coli 30. dextran sulphate sodium salt (36500 50000 m wt) 31. acacetin 32. ponceau 33. annexin v 34. propodeum iodide 35. sterile glucose 36. 4perc. buffered paraformaldehyde, 37. glacial acetic acid 38. acetic acid 39. acetone 40. sds 41. sybr green rt pcr 42. evodiamine 43. rotenone 44. diphenyleneiodonium chloride (dpi) 45. lipofectamine 2000 transfection reagent 46. fibronectin lyophilized powder 47. s ampa 48. 3 methyladenine 49. trizol 50. h2so4 51. sodium chloride 52. tween 20 53. skim milk defatted milk powder 54. trypan blue dye 55. annexin v fitc 56. 57. sheath fluid 58. pha l (l phytohemagglutinin) 59. pha e (e phytohemagglutinin) 60. con a (concanavalin a) 61. swainsonine 62. cycloheximide 63. actinomycind 64. trypsin 65. penicillin+streptomycin pentrap antibiotic solution, 66. amphotericin antimycotic solution 67. cell scraper 68. sulpho nhs 69. mes monohydrate 70. dmso 71. edac 72. thionyl chloride 73. rink amide (aminomethyl)polystyrene 74. annexin v : pe apoptosis detection kit 75. egfr antibody (528) alexa fluor® 647 76. cdcl3 (chloroform d) nmr solvent 77. dextran from leuconostoc spp. mr ~70,000 78. gel filtration standard lyophilized 79. polycaprolactone, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 120. syringes 1 ml 121. syringes 2 ml 122. syringes 5 ml 123. syringes 50 ml 124. stainless steel forceps (blunt ) 125. stainless steel forceps (pointed) 126. cryogenic vial sterile 2.0 ml 127. ph paper 2 10.5) 128. parafilm m usa 129. glass slides standard grade 130. microscope cover glass standard grade 131. sterile scalpel blade no.11 132. stainless steel scalpel holder no.3 133. stainless steel forceps (blunt ) 134. stainless steel forceps (pointed) 135. standard mambrane filter (0.22um) 136. pipette fillers 137. sybr green 138. taqman probe 139. sequencing chemicals 140. primer synthesis 141. antibiotics 142. cloning vectors (plasmids) 143. bacterial cells 144. membranes for blotting 145. rt pcr and pcr chemicals 146. moleculannual/repair markers 147. bacterial culture media 148. plant tissue culture media 149. dyes 150. petri dish plates 151. trizmabase, tris 152. ethanol, methanol 153. edta 154. naoh 155. potassium acetate 156. sodium acetate 157. glacial acetic acid 158. propanol 2 159. chloroform 160. isoamyl alcohol 161. agarose 162. ethidium bromide, 163. bromophenol blue 164. sodium chloride 165. magnesium chloride 166. sodium doecyl sulfate 167. glycerol 168. iptg 169. x gal 170. solarite soils for tissue culture, antibody 1. gapdh abs 2. secondary antobody anti mice 3. secondary antobody anti rabbit 4. actin abs 5. lamin abs 6. alexa fluor 488 anti mouse 7. alexa fluor 568 anti rabbit 8. 9. anti egfr antibody 10. anti phospho egfr antibody (y1173) 11. vwf abs 12. brcc36 antibody 13. hmgcr antibody 14. cox 2 antibody 15. laminb1 antibody 16. p 21 antibody 17. cox 2 (complex ii) abs mitochondrial loading control 18. anti tubulin(tu 02) antibody 19. zeb 1 antibody 20. twist antibody 21. phospho chk1 (ser 345) (133d3) 22. total chk1 23. rad51 24. glutamate receptor 1 antibody 25. phospho p38 mapk (thr180/tyr182) 26. p38 mapk antibody, kit 1. human inflammation array q1 2. lipoxygenase inhibitor screening assay kit 3. hegf recombinant protein 4. insulin eliza kit 5. prostaglandin e2 (pge2) eia kit – monoclonal 6. dual luciferase® reporter assay system luciferase assay kit for nf κb 7. saec cells growth medium bullet kit 8. 8 ohdg elisa kit 9. griess reagent 10. prostaglandin e2 (pge2) eia kit monoclonal 11. kinase assay kit 12. glutamate release assay kit 13. growth factor kit 14. temphil rchartered accountant kit 15. ta cloning kit 16. gel extraction kit 17. miniprep kit 18. midiprep kit 19. rna and rnai isolation kit 20. dna isolation kit 21. protein isolation kit 22. pcr purification kit, inhibitor 1. phosphatase inhibitor 2. protease inhibitor 3. rnase inhibitor 4. actinomycin d 5. cyclohexamide (chx) 6. ns398 – cox 2 inhibitor 7. myxothiazol, primers/oligo dt 1. gapdh primer 2. primers: (1) human cysteinyl leukotrine receptor 1 (hcyslt1 receptor): n terminal / r1 forward, 5 atggatgaaacaggaaatctgacag 3; c terminal / r1 reverse, 5 cctcttctttatacatttcatatc 3 (2) human cysteinyl leukotrine receptor 2 (hcyslt2 receptor): n terminal / r2 forward, 5 accttcagcaataacaacagc 3; c terminal / r2 reverse, 5` cgtttctgtctgacgtatttc 3 3. rt primer (degenerate rt primer) for mirna, (hplc grade) sequence: 5’caggtccagtttttttttttttttvn3’ where (v=a, c and g), (n=a,c,g and t) 4. mir143 primer 5. u6 snrna primer 6. hmgcr primer 7. 8. primers for sirna p21 9. primers for sirna p27 10. primers for sirna control 11. cd1d primers 12. cd1d sequencing and analysis through maldi tof 13. cyclin e primer 14. cdk2 primer 15. si rna cyclin 16. si rna cdk2 life technologies (#1 ggagcuuaaccauccuaautt 3 ggaaguuucaguauuagautt 17. oligo dt 18. gnt iii primer and gnt v primer (for rt pcr and cloning) 19. integrin beta3 and beta6 primer (cloning) 20. sirna 21. e cadherin rt pcr primers 22. n cadherin rt pcr primers, 23. vimentin rt pcr primers 24. integrins rt pcr primers 25. laminin rt pcr primers 26. collagen rt pcr primers 27. fibronectin rt pcr primers 28. egfr rt pcr primers 29. pcna rt pcr primers 30. p53 rt pcr primers 31. hif1α rt pcr primers 32. vegf rt pcr primers, 23. vimentin rt pcr primers 24. integrins rt pcr primers 25. laminin rt pcr primers 26. collagen rt pcr primers 27. fibronectin rt pcr primers 28. egfr rt pcr primers 29. pcna rt pcr primers 30. p53 rt pcr primers 31. hif1α rt pcr primers 32. vegf rt pcr primers, proteins/ladder 1. precision marker western blotting 2. 100bp dna ladder 3. hegf recombinant protein 4. visfatin (mouse) protein 5. human ldl 6. il 1beta human recombinant protein 7. precision marker western blotting, cells 1. saec cells 2. human adipose derived mesenchymal stem cells, miscellaneous 1. gloves 2. blotting paper (western) 3. face mask 4. blotting paper 5. tissue rolls 6. x ray films, 7. skim milk defatted milk powder 8. parafilm 9. biohazard bags (big black bags) 10. pvdf membrane 11. co2 cylinder 12. liquid nitrogen 13. syringe filter 14. blotting paper 15. autoclave bags 16. mask 17. blotting paper 18. autoclavable bags 19. tissue rolls 20. phstrip 21. phstrip 22. phstrip 23. phstrip 24. freeze tag transparent 25. freeze tag 26. freeze tag, white lable 27. ph eletrode, 1. nitrogen gas 2. zero air gas 3. helium gas 4. argon gas 5. carbondioxide gas 6. acetylene gas 7. oxygen gas 8. nitrous oxide gas 9. hydrogen gas 10. liquid nitrogen gas 11. liquid helium gas, 1. beaker 5ml 2. beaker 10 ml 3. beaker 25ml 4. beaker 50ml 5. beaker 100ml 6. beaker 250ml 7. beaker 500ml 8. beaker 1000ml 9. round bottom flask 10ml 10. round bottom flask 25ml 11. round bottom flask 50ml 12. round bottom flask 100ml 13. round bottom flask 250ml 14. round bottom flask 500ml 15. round bottom flask 1000ml 16. volumetric flask 5ml 17. volumetric flask 10ml 18. volumetric flask 25ml 19. volumetric flask 50ml 20. volumetric flask 100ml 21. volumetric flask 250ml 22. volumetric flask 500ml 23. volumetric flask 1000ml 24. conical flask 50ml 25. conical flask 100ml 26. conical flask 250ml 27. conical flask 500ml 28. burette 25ml 29. burette 10ml 30. sample vial 5ml, 31. sample vial 15ml 32. sample vial 30ml 33. sample vial 10 ml 34. funnel different size 35. watch glass different size 36. petri dish different size 37. buckner funnel 38. filtration flask 60ml 39. filtration flask 125ml 40. filtration flask 250ml 41. glass road 42. dropping bottle with different size 43. measuring cylinder 5ml 44. measuring cylinder 10ml 45. measuring cylinder 25ml 46. measuring cylinder 50ml 47. measuring cylinder 100ml 48. pipette 1ml 49. pipette 2ml 50. pipette 5ml 51. pipette 10ml 52. pipette 25ml 53. wire gauge for lab 54. test tube rack with diff. shapes 55. test tube with different size 56. condenser with different size 57. column with different size 58. separating funnel 50ml 59. separating funnel 100ml 60. separating funnel 250ml 61. glass dropper 62. melting tube 63. capillary tube 64. cotton 65. characterization dishes (glass water bath) with different size 66. desiccator with different size 67. a 1, reduction adapters socket 14/23 cone 19/26 68. a 1, reduction adapters socket 14/23 cone 24/29 69. a 1, reduction adapters socket 14/23 cone 29/32 70. a 1, reduction adapters socket 19/26 cone 24/29 71. a 1, reduction adapters socket 19/26 cone 29/32 72. a 1, reduction adapters socket 24/29 cone 29/32 73. a 2, expansion adapters socket 19/26 cone 14/23 74. a 2, expansion adapters socket 24/29 cone 19/26 75. a 2, expansion adapters socket 24/32 cone 14/23 76. a 2, expansion adapters socket 29/32 cone 24/29 77. a 2, expansion adapters socket 29/32 cone 19/26 78. a 2, expansion adapters socket 29/32 cone 14/23 79. a 9, cone adapters, straight connection with stopcock, cone 14/23 80. a 9, cone adapters, straight connection with stopcock, cone 19/26 81. a 9, cone adapters, straight connection with, stopcock, cone 24/29 82. b 24, dropping bottles with pipette stopper, cap diff. sizes 83. silicon oil (for oil bath 250+0c) 84. round/octagon magnetic stirrer bannual/repair with pivot ring diff sizes 85. clamp diff size and shape 86. clamp stand 87. bosshead diff size and shape 88. magnetic retriever 89. tlc plates (merck) 90. distillation condenser with diff size 91. dishes crystallizing (oil bath) with diff size 92. glass stopper hexagonal/ round with diff neck size 93. syringe (0 50 μl) 94. tlc capillary 95. tlc chamber 96. bottles, dropping with pipette & rubber teat with diff sizes 97. vetro clean 98. flasks, filtering, bolt neck, with tubulation (250 ml) 99. dishes 100 x 50 100. dishes, culture, petri 50 x 17 101. micro centrifuge tubes (500015, 500017) 102. semi micro buchner funnel 103. magnetic bead 104. sample vial 10ml 105. centrifuge tubes: 500031 500041, etc....